ISOLATED MODIFIED CAS9 MOLECULE, METHOD TO PRODUCE A MODIFIED CAS9, PROTEIN OR RIBONUCLEOPROTEIN COM

专利摘要:
to address the limitations arising from nonspecific genomic cleavages of the cas9 of streptococcus pyogenes (spcas9) and to identify variants with greater cleavage fidelity, the present invention describes a yeast-based assay that allows the simultaneous assessment of targeted and off-target activity to two engineered genomic targets. the selection of spcas9 variants obtained by random mutagenesis of the red-ii domain allowed the identification of hits with greater reasons on the target / off target. the best performing nuclease, evocas9, was isolated by combining the mutations identified in a single variant. side-by-side analyzes with rationally designed variants previously reported demonstrated a significant improvement in the fidelity of evocas9 of the present invention.
公开号:BR112019016765A2
申请号:R112019016765-0
申请日:2018-02-14
公开日:2020-05-26
发明作者:Cereseto Anna；Casini Antonio；Petris Gianluca；Inga Alberto；Olivieri Michele
申请人:Universita' Degli Studi Di Trento；
IPC主号:

专利说明:

ISOLATED MODIFIED CAS9 MOLECULE, METHOD TO PRODUCE A MODIFIED CAS9, PROTEIN OR RIBONUCLEOPROTEIN COMPLEXES OR COMPLEXES OF MIXED OR LIPID, COMPOSITE, LIPID, FUSION PROTEIN, NUTRITION, NUTRITION, NUTRITION IN VITRO USE OF A MODIFIED RECOMBINANT CAS9, PARTS KIT, AND, IN VITRO METHOD TO CHANGE A CELL GENOME
FIELD OF THE INVENTION
[001] The present invention belongs to the fields of nucleic acid-binding enzymes and proteins, in particular Cas9 variants. TECHNICAL STATUS
[002] It is observed that the number of biotechnological applications involving the CRISPR-Cas9 system has increased a lot in recent years, driven by the flexibility and efficiency of this new genome editing tool. Target sites are generally recognized by Cas9 through a so-called "guide RNA" (RNAg) sequence complementary to a target nucleic acid, including a protospace sequence. Target recognition also requires the presence of a short neighboring PAM sequence (adjacent protospacer motifs). The target nucleic acid is usually DNA, but in some circumstances it can also be RNA. Guide RNAs can be formed by one or more small RNAs. Genome editing using the CRISPR-Cas9 approach has been successfully applied to a variety of cell types and species, clearly demonstrating the efficiency and robustness that should characterize game-changing technology. Importantly, both basic and therapeutic-oriented research applications, in addition to efficiency, require high specificity of targeting for editing. However, several studies have shown that Cas9 cleavages in the
Petition 870190078259, of 8/13/2019, p. 10/85
2/57 genomes are not always directed to the intended sites, and unwanted lesions can be introduced in regions of DNA that share different levels of similarity with the selected target. In addition, predicting such unwanted activity is difficult and often unreliable, due to the absence of simple rules that control the phenomenon. Furthermore, the assessment of off-target effects is not always simple, and the results obtained using different methods are often not in agreement. Consequently, the enhancement of the specificity of the CRISPR-Cas9 tool kit is a very desirable improvement of this key technology, allowing its safe use in all fields of application, especially in human therapeutic applications.
[003] Different strategies have been proposed to reduce the introduction of unwanted CRISPR-Cas9 mutations, such as strict control of intracellular levels of Streptococcus pyogenes Cas9 (SpCas9), the introduction of engineered RNAsg, distinguished by shorter protospacers with less complementarity with the target sequence (truncated g-RNAs), the fusion of SpCas9 in the specific DNA binding domain to direct its binding, or the exploration of paired SpCas9 nickases and paired catalytically inactive SpCas9 fused to the endonuclease FokI domain. However, none of these approaches are free from outside the target and, due to their intrinsic molecular complexity, are often deficient in activity on the target.
[004] Recently, two groups reported the rational genetic modification guided by the structure of SpCas9 variants, distinguished by a lower propensity to cleave sites outside the target.
[005] Slaymaker IM et al. (Science. 2016, 351 (6268): 84-8) generated three SpCas9 mutants both with high efficiency (wild type levels close to insertion-elimination formation in the target, indel) and with specificity (no indel formation detectable at the sites off target
Petition 870190078259, of 8/13/2019, p. 11/85
3/57
EMX (l) and VEGFA (l), standard loci for specificity testing): SpCas9 (K855A), SpCas9 (K810A / K1003A / R1060A) [also referred to as eSpCas9 (1.0)], and SpCas9 (K848A / K1003A / R1060A) [also referred to as eSpCas9 (ll)].
[006] Kleinstiver BP et al. (Nature. 2016, 529 (7587): 490-5) generated 15 different SpCas9 variants that present all possible single, double, triple and quadruple combinations of N497A, R661A, Q695A and Q926A substitutions. The triple mutated variant (R661A / Q695A / Q926A) and the quadruple substituted variant (N497A / R66IA / Q695A / Q926A ₄ hereinafter referred to as SpCas9-HFl) both showed a minimal interruption of EGFP almost at background levels with four incompatible RNAsgs .
[007] Likewise, from these recent efforts, it is evident that a major need in the field is the generation of genome editing systems with no off-target activity.
[008] The aim of the present invention is to provide at least alternative high-fidelity Cas9 variants.
SUMMARY OF THE INVENTION
[009] The subject of the present invention is an isolated modified Cas9 molecule comprising at least one mutation located at amino acid residue positions selected from the group consisting of: K377, E387, D397, R400, D406, A421, L423, R424 , Q426, Y430, K442, P449, V452, A456, R457, W464, M465, K468, E470, T474, P475, W476, F478, K484, S487, A488, T496, F498, L502, N504, K506, P509 , N522, E523, K526, L540, S541,1548, D550, F553, V561, K562, E573, A589, L598, D605, L607, N609, N612, E617, D618, D628, R629, R635, K637, L651, K652 , R654, T657, G658, L666, K673, S675C, I679V, L680, L683, N690, R691, N692, F693, S701, F704, Q712, G715, Q716, H723,1724, L727,1733, L738 and Q739;
Petition 870190078259, of 8/13/2019, p. 12/85
4/57 where the position of the modified amino acid sequence is identified by reference to the amino acid numbering in the corresponding position of a mature unmodified Cas9 of Streptococcus pyogenes (SpCas9), as identified by SEQ ID NO: 1.
[0010] In a preferred embodiment, the modified Cas9 comprises at least one mutation at the K526 position.
[0011] Variants of SpCas9, according to the invention, were initially obtained by random mutagenesis of their REC-II domain and were selected for the identification of hits with increased target / off-target ratios, by means of an assay based on of yeasts that allows to simultaneously evaluate the activity on the target and off-target directed to two engineered genomic targets. After further validation in mammalian cells, Cas9 variants according to the invention were generated. Surprisingly, a SpCas9 modified according to the invention showed significantly reduced off-target activity when compared to wild-type SpCas9, and side-by-side analyzes with rationally designed variants demonstrated a significant improvement in the fidelity of a SpCas9 variant of the invention. . In addition, a SpCas9 modified according to the invention, and with the additional D10A and H840A mutations fused to a transcriptional activation domain (VP64), showed significantly reduced off-target activity when compared to the wild type Cas9 variant containing the D10A mutations and H840A.
DETAILED DESCRIPTION OF THE INVENTION
[0012] The present invention describes isolated Cas9 molecules with increased specificity, obtained by random mutagenesis of the REC9-II domain of Cas9, and screening using a yeast-based assay to simultaneously assess activity on the target and off-target of each variant generated. The selected hits were further refined by
Petition 870190078259, of 8/13/2019, p. 13/85
5/57 screening on a mammalian system.
[0013] In a first aspect of the invention, the Cas9 variants comprise at least one mutation located at amino acid residue positions selected from the group consisting of K526, K377,
E387, D397, R400, D406, A421, L423, R424, Q426, Y430, K442, P449,
V452, A456, R457, W464, M465, K468, E470, T474, P475, W476, F478,
K484, S487, A488, T496, F498, L502, N504, K506, P509, F518, N522,
E523, L540, S541,1548, D550, F553, V561, K562, E573, A589, L598, D605, L607, N609, N612, E617, D618, D628, R629, R635, K637, L651, K652, R654, T657, R654, T657, G658, L666, K673, S675,1679, L680, L683, N690, R691, N692, F693, S701, F704, Q712, G715, Q716, H723, 1724, L727, 1733, L738 and Q739;
wherein the position of the modified amino acid sequence is identified by reference to the amino acid numbering in the corresponding position of a mature unmodified Cas9 of Streptococcus pyogenes (SpCas9), as identified by SEQ ID NO: 1.
[0014] Preferably, according to the invention, the K526 position mutation is selected from the group consisting of K526N and K526E; more preferably K526E.
[0015] According to a preferred embodiment of the invention, the mutated K526 modified Cas9 comprises one or more additional mutations located at the amino acid residue positions selected from the group consisting of:
K377, E387, D397, R400, Q402, R403, F405, D406, N407,
A421, L423, R424, Q426, Y430, K442, P449, Y450, V452, A456, R457,
W464, M465, K468, E470, T472, 1473, T474, P475, W476, F478, K484,
S487, A488, M495, T496, N497, F498, L502, N504, K506, P509, Y515,
F518, N522, E523, L540, S541,1548, D550, F553, V561, K562, E573, A589, L598, D605, L607, N609, N612, E617, D618, D628, R629, R635, K637,
Petition 870190078259, of 8/13/2019, p. 14/85
6/57
L651, K652, R654, T657, G658, W659, R661, L666, K673, S675, 1679, L680, L683, N690, R691, N692, F693, Q695, H698, S701, F704, Q712, G715, Q716, H715, Q716, H715, Q716 H723,1724, L727, A728,1733, L738, Q739.
[0016] The one or more additional mutations are a number between 1 and 8.
[0017] Preferably, one or more additional mutations are selected from the group consisting of:
K377E, E387V, D397E, R400H, Q402R, R403H, F405L, D406Y, D406V, N407P, N407H, A421V, L423P, R424G, Q426R, Y430C, K442N, P449S, Y450A, Y4504, Y450, R457Q, W464L, M465R, K468N, E470D, T472A, I473F, I473V, T474A, P475H, W476R, F478Y, F478V, K484M, S487Y, A488V, M495V, M495T, T496A, N49, P509L, Y515N, F518L, F518I, N522K, N522I, E523K, E523D, L540Q, S541P, I548V, D550N, F553L, V561M, V561A, K562E, E573D, A589T, L598P, N60, N60, N60, N60, N60 E617K, D618N, D628G, R629G, R635G, K637N, L651P, L651H, K652E, R654H, T657A, G658E, W659R, R661A, R661W, R661L, R661Q, R661S, L666P, K6, 666, R691Q, R691L, N692I, F693Y, Q695A, Q695H, Q695L, H698Q, H698P, S701F, F704S, Q712R, G715S, Q716H, H721R, H723L, I724V, L727H, A7287, A728,
[0018] In preferred embodiments the total number of said previous mutations is between 1 and 9; preferably between 1 and 5; more preferably between 1 and 4.
[0019] SEQ ID N: 1 is the sequence with accession number NP_269215 (NCBI) referred to SpCas9.
[0020] According to the invention, the modified polypeptide, excluding mutations, preferably has an identity of at least
Petition 870190078259, of 8/13/2019, p. 15/85
7/57 minus 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% with SEQ ID N:
1.
[0021] The percentage identity between two polypeptides or nucleic acid sequences can be determined by those skilled in the art by using alignment software (ie, the BLAST program).
[0022] Preferably, the modified Cas9 is a S. pyogenes Cas9. In some embodiments Cas9 is an orthologous SpCas9 (ie, S. thermophilus, S. aureus, N meningitides'). In some embodiments, the Cas9 orthologist has at least 10% or 25% amino acid identity with the Reel-II domain of SpCas9, and complete amino acid identity of any percentage between 10%, or 25%, and 100% for SpCas9. Those skilled in the art can determine the appropriate homologous residues to be modified by sequence and / or structural alignments. The identified amino acids can be conservatively modified with substitutions in the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; phenylalanine, tyrosine.
[0023] The modified polypeptide maintains the ability to interact with RNAsg and / or with a target DNA or RNA.
[0024] According to the invention, an XlnnnX2 mutation means that, in the nnn position, the amino acid X2 is present in place of the amino acid XI, which is present in the wild type polypeptide; thus, for example, K526E means that the amino acid at position 526 corresponds to a glutamic acid (Glu or E), in place of the amino acid lysine (Lys or K) that is present in the wild type polypeptide.
[0025] According to a preferred embodiment of the invention, the modified Cas9 polypeptide comprises a mutation at position K526 and one or more additional mutations at a position selected from the group consisting of Y450, M495, Y515, R661, N690, R691, Q695 , H698;
Petition 870190078259, of 8/13/2019, p. 16/85
8/57 preferably M495, Y515, R661, H698.
[0026] According to a preferred embodiment of the invention, at least one additional mutation is selected from the group consisting of Y450S, M495V, Y515N, R661X, N690I, R691Q, Q695H, H698Q; preferably selected from the group consisting of M495V, Y515N, K526E, R661X, H698Q; where X is an amino acid selected from the group consisting of L, Q and S; preferably X is Q or S.
[0027] According to a preferred embodiment of the invention the modified Cas9 polypeptide comprises a double mutation selected from the group consisting of K526E + Y450S, K526E + M495V, K526E + Y515N, K526E + R661X, K526E + N690I, K526E + R691Q, K526E + Q695H and K526E + H698Q; where X is an amino acid selected from the group consisting of L, Q and S; preferably X is Q or S.
[0028] According to a preferred embodiment of the invention the modified Cas9 polypeptide, in the manner described above, comprises a triple mutation selected from the group consisting of M495V + K526E + R661X, Y515N + K526E + R661X, K526E + R661X + H698Q and M495V + Y515N + K526E; where X is an amino acid selected from the group consisting of L, Q and S; preferably X is Q or S.
[0029] According to a preferred embodiment of the invention, the modified Cas9 polypeptide, in the manner described above, comprises a quadruple mutation selected from the group consisting of M495V + Y515N + K526E + R661X and M495V + K526E + R661X + H698Q; where X is an amino acid selected from the group consisting of L, Q and S; preferably X is Q or S.
[0030] And above all preferred a modified Cas9 polypeptide, in the manner described above, comprising a quadruple mutation M495V + Y515N + K526E + R661Q (hereinafter also called evoCas9) or M495V + Y515N + K526E + R661S (hereinafter also
Petition 870190078259, of 8/13/2019, p. 17/85
9/57 called evoCas9-II).
[0031] In one aspect, the subject of the present invention is an isolated modified Cas9 polypeptide comprising at least one mutation selected from the group consisting of K377E, E387V, D397E, R400H, Q402R, R403H, F405L, D406Y, D406V, N407P, N407H , A421V, L423P, R424G, Q426R, Y430C, K442N, P449S, Y450S, Y450H, Y450N, V452I, A456T, R457P, R457Q, W464L, M465R, K468N, E470D, T47F4, I47, 47, , F478V, K484M, S487Y, A488V, M495V, M495T, T496A, F498I, F498Y, L502P, N504S, K506N, P509L, Y515N, F518L, F518I, N522K, N522I, L5K, E5, K23, E5 , D550N, F553L, V561M, V561A, K562E, E573D, A589T, L598P, D605V, L607P, N609D, N609S, N612Y, N612K, E617K, D618N, D628G, R629G, R6N, L65, R635, , G658E, W659R, R661W, R661L, R661Q, R661S, L666P, K673M, S675C, I679V, L680P, L683P, N690I, R691Q, R691L, N692I, F693Y, Q695H, Q7S, H6, H7 , Q716H, H721R, H723L, I724V, L727H, A728G, A728T, I733V, L 738P, Q739E, Q739P and Q739K.
[0032] According to a preferred embodiment, the invention relates to a modified Cas9 polypeptide comprising:
a single mutation selected from the group consisting of D406Y, W464L, T474A, K526E, N612K, L683P; or a double mutation selected from the group consisting of R400H + Y450S, D406V + E523K, A421V + R661W, R424G + Q739P, W476R + L738P, P449S + F704S, N522K + G658E, E523D + E617K, L540Q + L607P, R540 + 65 S675C + Q695L and I679V + H723L; or a triple mutation selected from the group consisting of K377E + L598P + L651H, D397E + Y430C + L666P, Q402R + V561M + Q695L, N407P + F498I + P509L, N407H + K637N + N690I, Y450H + F553,
Petition 870190078259, of 8/13/2019, p. 18/85
10/57
Y450N + H698P + Q739K, T472A + P475H + A488V, I473F + D550N + Q739E, F478Y + N522I + L727H, K484M + Q695H + Q712R, S487Y + N504S + E573D, T496A + N6, R49 + E6 H721R + I733V;
a quadruple mutation selected from the group consisting of F405L + F518L + L651P + I724V, L423P + M465R + Y515N + K673M,
R457P + K468N + R661W + G715S, E470D + I548V + A589T + Q695H,
A488V + D605V + R629G + T657A and M495V + K526N + S541P + K562E; or five mutations selected from the group consisting of R403H + N612 Y + L651P + K652E + G715S;
six mutations selected from the group consisting of E387V + V561A + D618N + D628G + L680P + S701F, R403H + K526E + N612Y + L651P + K652E + G715S, R403H + M495T + N612Y + L651P + K652E + G715
R403H + L502P + N612Y + L651P + K652E + G715 S,
R403H + K506N + N612Y + L651P + K652E + G715 S,
R403H + N612Y + L651P + K652E + N692I + G715S; or seven mutations selected from the group consisting of
R403H + A456T + N612Y + L651P + K652E + G715S + G728T, R403H + F498Y + N612Y + L651P + K652E + R661L + G715S,
R403H + Q426R + F478V + N612Y + L651P + K652E + G715S; or eight mutations selected from the group consisting of R403H + R442N + V452I + N609S + N612Y + R635G + L651P + K652E + F693Y + G 715S; or nine mutations selected from the group consisting of R403H + R457Q + F518I + N612Y + R635G + L651P + K652E + F693Y + G715S. Preferably, according to the invention, the modified Cas9 polypeptide comprises at least one mutation selected from the group consisting of Y450S, M495V, Y515N, K526E, R661X, N690I, R691Q, Q695H, H698Q; where X is selected from the group consisting of L, Q and S;
Petition 870190078259, of 8/13/2019, p. 19/85
11/57 preferably X is Q or S.
[0034] In some modalities, the said mutations identified by Cas9 are adequate to improve the specificity of other variants of Cas9 nuclease so far reported (SpCas9-HFl-4, eSpCas9 (1.0) (1.1.)). Therefore, optionally the Cas9 variant described above can additionally comprise one or more additional mutations in residues L169A, K810A, K848A, Q926A, R1003A, R1060A, D1135E.
[0035] In some embodiments, said mutations identified by Cas9 are suitable for improving the specificity of another Cas9 nickase, dCas9-FokI or dCas9. Therefore, optionally, the Cas9 variant described above can additionally comprise at least one additional mutation in a residue selected from the group consisting of D10, E762, D839, H840, N863, H983 and D986 to decrease nuclease activity. Preferably, such additional mutations are D10A, or DION and H840A, H840N or H840Y. Preferably, said mutations result in a Cas9 nickase or a catalytically inactive Cas9 (Ran F et al. Cell. 2013, 154 (6): 1380-1389; Maeder M et al. Nature Methods. 2013, 10 (10): 977-979).
[0036] In some embodiments, said mutations identified by Cas9 are suitable for improving the specificity of Cas9 nuclease variants that recognize alternative PAM sequences. Therefore, optionally, the Cas9 variant described above may additionally comprise one or more additional mutations in residues D1135V / R1335Q / T1337R (QVR variant), D1135E / R1335Q / T1337R (EVR variant), D1135V / G1218R / R1335Q / T1337R (VRQR variants ), D1135V / G1218R / R1335E / T1337R (VRER variants) according to US patent US20160319260.
[0037] Additionally, the subject of the present invention is also a variant of the SpCas9 protein, in the manner described above, fused to other polypeptide sequences.
Petition 870190078259, of 8/13/2019, p. 20/85 η / 5Ί
Preferably, the Cas9 variant is fused to the amino acid sequences encoding protein markers (i.e., V5 marker, FLAG marker, myc marker, HA marker, GST marker, polyHis marker, MBP marker), proteins, domain protein, transcription modulators, enzymes that act on small molecule substrates, DNA, RNA and protein modification enzymes (i.e., adenosine deaminase, cytidine deaminase, guanosyl transferase, DNA methyltransferase, RNA methyltransferases, DNA demethylases, RNA demethylases, dioxigenes , polyadenylate polymerases, pseudouridine synthases, acetyltransferases, deacetylase, ubiquitin ligases, deubiquitinases, kinases, phosphatases, NEDD8-ligases, de-NEDDylases, SUMO-ligases, deSUMOilases, histone deacetylases, histone deacetylases, histone deacetylases, histone deacetylases protein and DNA, RNA-binding proteins, polypeptide sequences with specific biological functions (i.e., s nuclear localization signals, signs of mitochondrial localization, signs of plastidial localization, signs of subcellular localization, signs of destabilization, Geminin destruction box motifs), biological binding motifs (ie, protein MS2, Csy4 and lambda N).
[0039] Additionally, the subject of the present invention is a method for producing a Cas9 variant in the manner described above, said method comprising reconstituting the Cas9 variant from one or more fragments thereof; preferably by means of which an intein or an intron protein, or a dimerization domain is included in the Cas9 polypeptide.
[0040] In some modality, the reconstitution step can be performed in vitro, in some other modality it can be performed in vivo (see below).
[0041] Preferably, such fragments can be induced to reconstitute the Cas9 protein by dimerizing a Cas9-division (Wright
Petition 870190078259, of 8/13/2019, p. 21/85
13/57
AV et al. PNAS 2015 12 (10): 2984-9; Liu KI et al. Nat Chem Biol. 2016, 12 (11): 980-987).
[0042] Preferably, such fragments can be induced to reconstitute a catalytically active Cas9 protein by dimerizing the integin of a Cas9-division (Truong DJ et al. Nucleic Acids Res 43 (13): 6450-8).
[0043] According to the invention, a vector is a system suitable for the release or expression of a nucleotide or protein sequence.
[0044] Additionally, the subject of the present invention also refers to protein or ribonucleoprotein complexes or mixed protein, ribonucleoprotein and lipid complexes containing the modified Cas9 polypeptide (Cas9-RNAsg complexes, and their conjugation with additional protein, nucleic acid or components lipids such as, but not limited to, cell penetrating peptides, nucleic acid aptamers and lipid vesicles).
[0045] Additionally, the subject of the present invention is a protein or protein ribonucleotide vector containing the modified Cas9 polypeptide. In some embodiments, such a vector is a natural or artificial vesicle or complex (see above). In some embodiments, such a vector is derived from a packaging or delivery cell. In some embodiments, such a vector is extracellular vesicle-based structures (i.e., but without limitation, exosomes and exosome-like structures), or viral particles or viral-type particles containing the modified Cas9 polypeptide according to the invention.
[0046] Additionally, the subject of the present invention is a sequence of nucleotides that encodes a modified Cas9 polypeptide, as described above, and fragments thereof.
[0047] Preferably, according to the invention, the nucleotide sequence encoding a modified Cas9, as described
Petition 870190078259, of 8/13/2019, p. 22/85
14/57 previously, or fragments thereof, is based on SEQ ID N: 2, which is the sequence with accession number NC_002737, or SEQ ID N. 3, which was obtained through codon optimization for expression in human cells , and shows the base substitutions that correspond to the mutations described above. The nucleotide sequence of the invention, which encodes a modified Cas9 polypeptide, preferably has, excluding mutations, an identity of at least 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% with SEQ ID NO: 2 or SEQ ID NO: 3.
[0048] Additionally, the subject of the present invention is a nucleic acid comprising the nucleotide sequence in the manner described above.
[0049] A method for producing a modified Cas9 polypeptide in the manner described above, whereby the modified Cas9 polypeptide is expressed by means of a nucleic acid, in the manner described above.
[0050] Additionally, the subject of the present invention is a vector comprising nucleic acid in the manner described above; wherein said vector is suitable for gene expression in prokaryotic cells or eukaryotic cells (e.g., yeast, mammalian cells, insect cells, plant cells). Preferably, the vector can be, but is not limited to, a plasmid, phagemid, an artificial bacterial or yeast chromosome, a DNA fragment or an RNA fragment, or an Agrobacterium-based vector or a viral vector.
[0051] The nucleic acid of the invention is preferably released by means of lentiSLiCES, allowing for additional specificity by means of a self-limiting circuit, as described in Italian patent application IT 102016000102542. The nucleic acid of the invention is preferably released by means of a vector retroviral, an EIAV vector, a SIV vector, an adenoviral vector, an AAV vector, a herpes vector, a Baculovirus vector, a
Petition 870190078259, of 8/13/2019, p. 23/85
15/57 Vaccinia virus vector, Sendai virus vector or bacteriophage. Preferably the bacteriophage vector is based on phage λ, phage, phage Pl.
[0052] Additionally, the subject of the present invention is a nucleic acid comprising fragments of the nucleotide sequence in the manner described above.
[0053] Preferably, when the translated polypeptides, encoded by the two or more different nucleic acids that comprise fragments of the nucleotide sequence, in the manner described above, can be used in vitro or in vivo to reconstitute a catalytically active variant of Cas9, in the manner described earlier.
[0054] Preferably, if such Cas9 fragments can be used to reconstitute Cas9 protein expression at the DNA level, exploring the recombination between different viral vectors (i.e., Wu Z et al. Mol Ther. 2010, 18 (1) 80-86).
[0055] Preferably, if such Cas9 fragments can be used to reconstitute a Cas9 protein at the transcription level by exploring transinsertion (Fine EJ et al. Sei Rep. 2015, 5: 10777).
[0056] Additionally, the subject of the present invention also refers to a cell engineered to encode a nucleic acid or a vector, in the manner described above, or a cell permanently modified by means of the Cas9 variant of the invention.
[0057] Preferably, the engineered cell is a prokaryotic cell, more preferably a bacterium.
[0058] Preferably, the engineered cell is a eukaryotic cell. Preferably, it is an animal cell. Preferably, the engineered cell is a mammalian cell. Most preferably, it is a human cell. Preferably, the engineered cell is a somatic cell, more preferably, it is a tumor cell, more preferably, it is a
Petition 870190078259, of 8/13/2019, p. 24/85
16/57 stem cell or an induced pluripotent stem cell.
[0059] Additionally, the subject of the present invention also refers to an animal engineered to encode a nucleic acid or a vector, in the manner described above, or an animal permanently modified by means of the Cas9 variant of the invention. Preferably, the animal is a model organism (i.e., Drosophila melanogaster, mouse, mosquito, rat), or the animal is a farm animal or a farmed fish or a pet. Preferably, the animal is a vector for at least one disease. Most preferably, the organism is a vector for human diseases (i.e., mosquitoes, ticks, birds).
[0060] Additionally, the subject of the present invention is an engineered plant using a nucleic acid or a vector, in the manner described above, or a plant permanently modified by means of the Cas9 variant of the invention. Preferably, the plant is a crop plant (i.e., rice, soy, wheat, tobacco, cotton, alfalfa, canola, corn, beets).
[0061] Additionally, the subject of the present invention also relates to a method for permanently modifying a cell, an animal or a plant, said method comprising using a Cas9 molecule of the invention to edit the DNA of the cell, animal or plant.
[0062] In addition, the subject of the present invention also relates to a nucleotide sequence or a nucleic acid or a vector, in the manner described above, for use as a medicine for gene therapy. In addition, the subject of the present invention also relates to a pharmaceutical composition comprising a nucleotide sequence or nucleic acid or vector, in the manner described above, and at least one pharmaceutically acceptable excipient.
[0063] Additionally, the subject of the present invention also relates to a pharmaceutical composition comprising a Cas9 polypeptide
Petition 870190078259, of 8/13/2019, p. 25/85
17/57 recombinant, containing the mutations described above and at least one pharmaceutically acceptable excipient.
[0064] Additionally, the subject of the present invention also refers to the in vitro use of a nucleotide sequence, or a nucleic acid, or a vector, in the manner described above, to engineer the genome, engineer the cell, protein expression or other biotechnology applications.
[0065] The additional theme of the invention is the use in vitro of a recombinant Cas9 polypeptide, containing the mutations described above, together with an RNAg to engineer the genome, engineer the cell, protein expression or other biotechnological applications.
[0066] The additional subject of the invention is a kit of parts, for simultaneous, separate or sequential use, comprising a nucleotide sequence, or a nucleic acid, or a vector, or a recombinant Cas9 polypeptide in the manner described above.
[0067] An in vitro or in vivo method for altering the genome of a cell, the method comprising expression in the modified Cas9 cell, in the manner described above, together with a guide RNA targeting a specific genomic sequence.
[0068] An in vitro or in vivo method for altering a cell's transcriptome, the method comprising expression in the cell of the modified dCas9-based transcriptional regulator, as described above, together with a guide RNA targeting a specific genomic sequence .
[0069] An in vitro or in vivo method for altering a cell's epigenome, the method comprising expression in the cell of the modified dCas9-based epigenome editor, as described above, together with a guide RNA targeting a genomic sequence specific.
[0070] The present invention will be better understood in the light of the following experiments.
Petition 870190078259, of 8/13/2019, p. 26/85
18/57
BRIEF DESCRIPTION OF THE FIGURES
[0071] Figure 1. Design of a yeast assay in vivo to quantify the activity on and off the SpCas9 target. Generation of reporter strains of yeast. The TRP1 and ADE2 loci were modified by inserting a reporter cassette containing a target site (TRP1) or different off-target sequences (ADE2, sequences are reported in the upper right box). The presence of regions of homology (HR) on both sides of the target allows efficient repair by annealing simple tape by cleavage by Cas9. Using appropriate selective plates it is possible to follow the editing situation of the two loci. The survival of a colony will indicate cleavage in the TRP1 target, while the color of the colony allows to assess the cleavage of ADE2 outside the target.
[0072] Figure 2. Validation of the yACMO strain using SpCas9 wild type. Quantification of the average percentage of red (on the target) and white (off-target) colonies after transformation of wild-type SpCas9 into the reporter strains yACMO-off l / off4, which stably express an RNAsg that corresponds to the sequence on the target at the TRP1 locus . Cas9 expression was induced for 24 hours before plating. Error bars represent s.e.m. for n = 3.
[0073] Figure 3. Selection of a target domain for generating a random library. SpCas9 domain schemes. The Reel-II domain (highlighted) is part of the alpha helical recognition lobe. BH: bridge propeller.
[0074] Figure 4. Yeast selection for high specificity variants of SpCas9 (a) Schematic representation of the yeast selection workflow, (b) Evaluation of activity on the target and specificity of SpCas9 variants obtained from yeast selection through analysis with the reporter strain yACMO-off4. Cas9 expression was induced for 5 hours before plating. See table 1 in the appendix, (c)
Petition 870190078259, of 8/13/2019, p. 27/85
19/57
Evaluation of the specificity of variant C13. C13 was transformed into the yACMO-offl / off4 reporter strains that express an RNAsg on the target, and the percentage of red (on the target) and white (off-target) colonies was assessed after 24 hours of Cas9 expression. Error bars represent s.e.m. for n = 3.
[0075] Figure 5. Selection of optimized SpCas9 variants in mammalian cells. 293 cells that stably express EGFP were transfected with single and double mutants (a), as well as triple (b), generated by the hierarchical combination of mutations obtained from the best performing isolated yeast variants, together with a target RNAsg (sgGFPon) or each of the incompatible guides. The loss of EGFP fluorescence was assessed by FACS analysis at 7 days after transfection. (c) Side-by-side comparison of the best variants generated with previously published mutants. The 293 cell line EGFP knockout assay was used to assess the specificity of the main isolated variants (VNEL, VNEQ and VNES variants), and to compare their performance with previously published high-fidelity mutants. The loss of EGFP fluorescence was assessed by FACS analysis at 7 days after transfection. sgGFP1314 contains incompatibilities at the PAM position 13 & 14 of the spacer sequence; sgGFP1819 contains incompatibilities at positions 18 &19; sgGFP18 contains a single mismatch at position 18. Dotted lines indicate on-target / off-target ratios calculated for the indicated on / off target pairs. The dotted lines indicate the background loss of EGFP fluorescence. Error bars represent s.e.m. for n> 2.
[0076] Figure 6. Activity on the evoCas9 target against EGFP. (a) evoCas9 activity against EGFP loci. 293 cells that stably express EGFP were transfected with wild-type SpCas9, evoCas9 (VNEQ) or the VNEL variant along with RNAssg that target different regions of the EGFP coding sequence. The loss of
Petition 870190078259, of 8/13/2019, p. 28/85
20/57 EGFP fluorescence was evaluated by FACS analysis at 7 days after transfection. Dashed lines indicate background loss of EGFP fluorescence. Error bars represent s.e.m. for n> 2. (b) Activity ratio in the evoCas9 target and the VNEL variant for wild type SpCas9 calculated in EGFP loci. The median and interquartile range is shown. A level of activity on the target above 70% of the wild type protein is indicated by the shaded area, (c) Intracellular expression of evoCas9. Western blot representative of lysates from 293T cells transfected with wild-type SpCas9, evoCas9 or the other high-fidelity variants. Tubulin was used as a charge control. SpCas9 is detected using an anti-FLAG antibody.
[0077] Figure 7. EvoCas9 activity in endogenous loci. (a) The activity of wild type SpCas9, evoCas9 and SpCas9-HFl directed to loci was compared by transfecting 293T cells and evaluating the formation of indel in 7 days after transfection, using the TIDE tool, (b) Activity ratio in the target evoCas9 and SpCas9-HFl for wild type SpCas9 calculated in endogenous loci. The median and interquartile range is shown. A level of activity on the target above 70% of the wild type protein is indicated by the shaded area. Error bars represent s.e.m. for n = 2.
[0078] Figure 8. Side-by-side comparison of the specificity of evoCas9 and SpCas9-HFl. (a) Activity outside the target of evoCas9 at selected loci. 293T cells were transfected with wild-type SpCas9, evoCas9 or SpCas9-HFl along with RNAssg that targets the FANCF site 2 or the CCR5 spll loci. The formation of indel at two previously validated off-target sites was assessed at 7 days after transfection, using the TIDE tool. Error bars represent s.e.m. for n = 2. (b) On-target / off-target ratios calculated from the average indel percentages obtained in (a). Dashed lines indicate target / off-target ratio of 1. (c) Schematic representation of the CCR5 locus and its off-target site in the
Petition 870190078259, of 8/13/2019, p. 29/85
21/57 highly homologous CCR2 gene. The simultaneous dividing of the two sites generates a chromosomal elimination of approximately 16 kb. Semi-quantitative PCR was performed on genomic DNA from 293T cells transfected with wild-type SpCas9, evoCas9 or SpCas9-HFl and the CCR5 guide RNA to assess the amount of chromosomal elimination generated in each condition. The FANCF locus was used as an internal normalizer. The amount of elimination was quantified using densitometry with ImageJ. Error bars represent s.e.m. for n = 2.
[0079] Figure 9. Validation of evoCas9 specificity by deep targeted sequencing. The deep targeted sequencing of previously validated off-target sites, with respect to the EMX1 site 1 locus (a) and the VEGFA site 3 locus (b), was carried out on genomic DNA from 293T cells that express both wild-type and evoCas9 , along with each specific RNAsg. Cells that do not express Cas9 were sequenced to determine background levels of indel. Genomic DNA from three biological replicates was mixed prior to the preparation of the library.
[0080] Figure 10. Specificity of the entire evoCas9 genome. (a) GUIDE-seq analysis of off-target sites with respect to the VEGFA site 2 locus, performed for both wild-type SpCas9 and evoCas9 in 293T cells. The black square indicates the site on the target, (b) Total number of off-target sites detected for wild type SpCas9 and evoCas9. The genomic DNA of the three biological replicates was mixed before the library was prepared.
[0081] Figure 11. Transcriptional activation of evo-dCas9. (a) Schematic representation of the transcriptional activating reporter based on the responsive element Tet (TRE) -EGFP. By binding dCas9-VP64 to TetO repeats, EGFP expression is activated, (b) EGFP activation was evaluated in 293T cells transfected with dCas9 or evo-dCas9 based on transcriptional activators, along with corresponding RNAssg guides
Petition 870190078259, of 8/13/2019, p. 30/85
22/57 (both with and without a 5 'incompatible G) or incompatible. TetOoff6 contains an incompatibility in position 6 of PAM, TetO-offl314 contains two incompatibilities in position 13-14 and TetO-offl819 contains two incompatibilities in position 18-19. (c) Value of activation of EGFP expression in relation to the non-targeted control, calculated from the data in (b). Error bars represent s.e.m. for n = 2. EGFP expression was assessed by FACS analysis 2 days after transfection.
[0082] Figure 12. Long-term specificity of evoCas9. SpCas9 (a), evoCas9 (b) and SpCas9-HFl (c) were stably expressed through lentiviral release in 293T cells that stably express EGFP. Each lentiviral vector carried an RNAsg on the target for the EGFP coding sequence, or different incompatible guides shown in Fig. 5. EGFP knockout was assessed by FACS analysis at the time points indicated in the graphs. The transduced cells were cultured in puromycin selection medium. Error bars represent s.e.m. for n = 2.
EXPERIMENTAL SECTION
Design of a reporter yeast strain for the detection of Cas9 activity
[0083] Saccaromyces cerevisiae was used as an experimental model to develop a selection of directed evolution to isolate highly specific SpCas9 variants. The advantage of using a yeast-based assay platform lies on the one hand in the similarities that yeast shares with bacteria, such as a fast rate of duplication, the ability to isolate single clones easily and the availability of fast and reliable transformation protocols ; on the other hand, DNA organization and yeast metabolism are similar to those of higher eukaryotic cells. Therefore, the yeast model offers a flexible platform for high yield selection, combined with similarities with a mammalian system that increases the robustness of the
Petition 870190078259, of 8/13/2019, p. 31/85
Selection result. Initially, a strategy to generate auxotrophic yeast reporter strains for the simultaneous evaluation of Cas9 target versus off target activity was determined. This approach consisted of testing the modification of two yeast genomic loci: TRP1 (chromosome IV) and ADE2 (chromosome XV). Using the perfect delitto approach, the wild type coding sequences of the two loci were divided into two halves, separated by the specific target sequence that corresponds to the RNAsg on the target in the case of the TRP1 locus, or by different off-target sequences in the case of the ADE2 locus ( outlined in Fig. 1). Each off-target (ADE2offl-off4, Table 4 in the appendix) contained a single correspondence positioned at increasing distances from the PAM sequence. A doubling of 100 bp was added on both sides of the target sequence (TRP1 or ADE2), and a stop codon was positioned immediately upstream, in between the two homology regions, to ensure premature translation interruption (Fig. 1) . The knockout of the TRP1 and ADE2 genes by inserting a reporter cassette produces deficiencies in the tryptophan and adenine metabolic pathways, suppressing growth in the absence of tryptophan and leading to the accumulation in the cell vacuole of an intermediate product of adenine biosynthesis when cells are grown in low concentrations of adenine, thus conferring a red pigmentation characteristic to colonies on agar plates. After the formation of double strand breaks induced by Cas9, each locus can be repaired efficiently by yeast cells using the single strand repair path, thanks to the presence of the two flanking homology regions, which obtain a reversion to the prototrophy for the two nutrients. The satisfactory editing event at each of the two loci can, in turn, be visualized using appropriate reporter plates, which are reduced in tryptophan and contain only low concentrations of adenine (SDfights, Fig. 1). The complete reading of the essay consists of a two-step process. THE
Petition 870190078259, of 8/13/2019, p. 32/85
24/57 The first step consists of assessing the cleavage efficiency on the target by comparing the number of colonies obtained on SDfight reporter plates with those obtained only during the selection for the total number of transformants (SDlu plates). The second step consists of counting the number of red colonies (TRPP / ADE2), which correspond to the cleavages on the target, and white colonies (TRP1 ⁺ / ADE2 ⁺ ), in which also the off-target locus has been edited, on the reporter plates for assessing activity on target versus off target. Four strains of yeast were generated containing four potential off-target sites (ADE2offl-off4), and were called yACMO-offl / off4. Then, the rate of spontaneous reversion for the ADE2 and TRP1 loci of the different yACMO strains was assessed to avoid introducing any confusing variables in the assay reading. The reversal of the TRP1 locus can, in fact, lead to the isolation of false positive clones, while spontaneous recombination of the ADE2 gene can generate false negative colonies. To approximate the experimental conditions used during the present test, each of the four strains was transformed separately with a plasmid encoding SpCas9; after 24 hours of incubation in selective medium, cells were spread on selective plates to assess the total number of transformants, and 1,000 times more cells were plated on reduced selective tryptophan or adenine plates to count the number of reverse mutants for each locus. Comparing the number of colonies obtained in the different selective conditions, it was possible to estimate an average reversal frequency of approximately 1-1.5 x 10 ' ⁵ for both the TRP1 and ADE2 loci, thus indicating an insignificant spontaneous reversal.
Validation of the yACMO reporter strain
[0084] The functionality of the reporter assay has been validated by testing the four reporter strains (yACMO-off l / off4) in combination with wild-type SpCas9. To maximize total efficiency, before the challenge with SpCas9, each of the strains was transformed in a stable manner with a plasmid
Petition 870190078259, of 8/13/2019, p. 33/85
25/57 that expresses the RNAsg in the target, perfectly matching the sequence in the target in the TRP1 locus. The four strains were then transformed with a plasmid for the expression of wild-type SpCas9 controlled by a galactose-inducible promoter and, after a 4-hour recovery incubation, induced overnight in media containing galactose before being plated on plates of SDlu and SD reporter fights. In these experimental conditions, 100% target cleavage was consistently achieved, while off-target activity, measured as the percentage of white colonies (TRP1 ⁺ / ADE2 ⁺ ) on reporter plates, increased according to the distance from the incompatible base of the PAM sequence, as expected (Fig 2). For the two most distant PAM targets (off3 and off4), SpCas9 was completely unable to discriminate between the corresponding sequence and the two incompatible sequences (Fig. 2).
[0085] Considering these results, the SpCas9 variants were selected using the yACMO-off4 strain, containing the strongest off-target sequence, in order to select mutants with a marked increase in fidelity.
Yeast-based selection for highly specific SpCas9 variants
[0086] Unlike published studies (Slaymaker IM et al., Science. 2016, 351 (6268): 84-8; Kleinstiver BP et al., Nature. 2016, 529 (7587): 490-5), the inventors believe that an impartial approach can lead to the isolation of non-trivial amino acid substitution, increasing the likelihood of obtaining a variant of SpCas9 with greater fidelity. To find a suitable target for random mutagenesis, the available structural data were analyzed to identify which SpCas9 domain may be more involved in the formation of such types of interactions. The nuclease lobe of Cas9 was excluded from this analysis, since it contains the two catalytic sites that must be conserved to maintain the activity of
Petition 870190078259, of 8/13/2019, p. 34/85
26/57 divage. The recognition lobe, containing the Reel, Rec2 domains and the helix of the bridge, has been reported to make several contacts with the RNAg: DNA pair. In addition, the recognition lobe as a total is one of the least conserved regions, across all three Cas9 families that belong to the CRISPR type II systems, indicating a high degree of sequence plasticity. The bridge helix, on the contrary, is one of the most conserved regions among different Cas9 orthologists, suggesting that its sequence is particularly important for nuclease function. The Recl-Rec2 region crosses over 600 amino acids, a dimension not suitable for random mutagenesis, but most of the interactive residues are located in the last portion of the Reel-II domain, approximately between residues 400 and 700 (Fig. 3).
[0087] A library of REC1-II variants, generated by error-prone PCR to contain approximately 4-5 mutations per molecule, was assembled directly into the yACMO-off4 yeast reporter strain, exploring homologous recombination between the REC1-II fragments mutagenized, containing appropriate homology arms, and a plasmid expressing a Galactose-inducible SpCas9, in which the same region was previously removed. The general selection workflow is outlined in Fig. 4a. After co-transformation and a recovery incubation overnight in SDlu medium, to allow repair of the plasmid encoding Cas9 by homologous recombination and selection for transformed cells, cultures were induced for 5 hours with galactose to express SpCas9 and then they were plated on several reporter plates of SDluta.v The induction time was reduced, in relation to previous experiments, to obtain variants that maintained high activity in the target, since it was observed that SpCas9 wild type can totally cleave the sequence on the target in this restricted time range (data not shown). After two days, multiple colonies were obtained and the red ones were streaked onto new plates
Petition 870190078259, of 8/13/2019, p. 35/85
27/57 reporters containing galactose, instead of dextrose, to reactivate the expression of SpCas9 and keep it constantly on to exacerbate any off-target effects. After 48 hours, the plasmids were recovered from the redest streaks and, after amplification in bacteria, were sequenced by Sanger to identify the mutations introduced in the REC1-II domain. Several amino acid substitutions have been identified, some of which were present more than once in the mutant cluster, in combination with groups of different mutations. Importantly, it is likely that mutants containing the same set of variations represent clones that are derived from the same original cell, which was replicated during the recovery incubation. However, given the diversity of substitutions obtained, this phenomenon did not affect the results of the selection. A again challenging experiment was then performed on the yACMO-off4 strain with each isolated variant, in order to more accurately assess its cleavage activity, discarding those that did not efficiently cut their target, purchased from SpCas9 wild type, and classifying the remaining ones according to the last parameter and its ability to discriminate off-target sites (Fig. 4b). To further validate the selection results, the specificity of those of the obtained variants (Cl3 variant) was evaluated in more detail challenging all four yACMO reporter strains. After 24 hours of Cas9 expression, the quantification of white and red colonies on reporter plates showed significantly reduced activity on the target when compared to wild type SpCas9 (compare Fig. 4c and Fig. 2).
Optimization of high-fidelity variants of SpCas9 in mammalian cells
[0088] A grouping of substitutions belonging to the best performing variants isolated from yeast, selected both according to the cleavage efficiency on the target and reduction of nonspecific activity, was selected. To obtain a significant increase in
Petition 870190078259, of 8/13/2019, p. 36/85
28/57 fidelity, with respect to the identified mutants, a hierarchical combination of these mutations was tested, since it is expected that some of the substitutions in each randomly generated variant will be neutral or harmful. The relative position of each substitution and of the double RNAsg: DNA, according to available structural data, was used as a first filtration criterion, identifying a first subset of mutations. In addition, he drew attention to a conformational grouping of substitutions located at the end of the REC1-II domain, which is in contact with the most distant PAM part of the target DNA sequence (nt. 17-20). Consequently, the mutations that belong to this group have been selected, although no interaction with the RNAsg: DNA pair has been previously reported. In particular, it was decided to add the mutations sequentially from the K526E mutant, which performed particularly well in the yeast assay (Fig. 4c). Notably, the K526E mutation is included in the aforementioned Reel-II domain (Fig. 3).
[0089] Using a reporter cell line that stably expresses EGFP (293multiGFP), activity on the target (sgGFPon) of double mutants was tested by evaluating the loss of fluorescence induced by displacement mutations in the EGFP coding sequence. In parallel, its ability to avoid cleavage from the same site, after the introduction into the RNAssg of one or two incompatible bases at distal positions of the PAM trinucleotide (position 18 for sgGFP18 and positions 18-19 for sgGFP1819), was evaluated. SpCas9 wild type was unable to distinguish between these substitute off-target sequences, as confirmed by the observation that they cleaved the target sequence with equal efficiency when guided by both corresponding and incompatible RNAssg, producing the same reduction in the percentage of EGFP ⁺ cells ( Figs. 5a). After a first selection cycle, the main performance substitutions
Petition 870190078259, of 8/13/2019, p. 37/85
29/57 were combined into triple mutants that were used to repeat the EGFP reporter cell line challenge (Fig. 5b). A last selection cycle was then performed after generating a quadruple mutant combining the best substitutions from the previous cycle (VNEL variant). In addition, another RNAsg containing two incompatibilities in a more proximal PAM region (positions 13 and 14, sgGFP1314) was tested to verify that the observed increase in VNEL variance fidelity was retained for mutations spanning the entire spacer sequence. The VNEL variant induced little or no loss of EGFP fluorescence for all incompatible guide RNAs, a result that was particularly impressive for RNAsg containing a single substitution at position 18 of PAM (sgGFP18). On the other hand, this large increase in specificity produced a small, though measurable, decrease in activity on the target (loss of ~ 20%, Fig. 5c). In order to solve this problem, two alternative derivatives of the VNEL variant (the VNEQ and VNES variants) were generated by rational design and tested using the same EGFP knockout assay. As expected, a complete restoration of cleavage efficiency on the target was observed, in parallel with a small increase in off-target activity. In general, the VNEQ mutant variant showed the best target / off target ratio (Fig. 5c).
[0090] Side-by-side comparison of quadruple mutants (VNEL, VNEQ, VNES variants) with previously published high-fidelity SpCas9-HFl and eSpCas9 (ll) variants, using the EGFP reporter cell line described earlier, revealed a marked increase in fidelity that was particularly evident using RNAsg containing a single mismatch at position 18. For this outside the particular substitute target, approximately a 17 to 4 fold absolute reduction in nonspecific cleavage was measured when comparing the VNEL, VNEQ and VNES variants with SpCas9- HFl, which according to the present experiments already
Petition 870190078259, of 8/13/2019, p. 38/85
30/57 was discriminating incompatible sites much better than eSpCas9 (l.l) (Fig. 5c). This observation was further confirmed by analyzing the on-target / off-target ratios of the different SpCas9 variants, calculated for the two strongest substitute off-target (sgGFP1819 and sgGFP18) (compare dotted lines in Fig.5c).
[0091] Next, the activity on the target of the VNEL and VNEQ variants was evaluated in more detail by targeting different regions of the EGFP coding sequence, using the 293multiGFP reporter cell line and measuring the loss of EGFP fluorescence. The VNES variant was excluded from the analysis, as it behaved similarly to the VNEQ mutant. According to previous results (Fig. 5c), levels of wild type activity were observed for VNEQ, while VNEL was slightly below the performance in some of the sites, with a significant drop in activity for one of the tested loci (Figs. 6a and 6b). To rule out the possibility that the different cleavage behavior measured at the target and off-target sites was due to a change in the intracellular levels of the SpCas9 variants, the levels of wild-type SpCas9, VNEL and VNEQ proteins, as well as the two previously published high-fidelity variants, eSpCas9 (ll) and SpCas9-HFl, were analyzed in 293T cells transfected with equal amounts of expression plasmids. As clearly shown by the results (Fig. 6c), no major difference in protein levels was observed. In view of the above, the VNEQ variant was further distinguished, since among the mutants analyzed here, activity levels were kept very close to the wild type and greatly reduced the cleavage of non-corresponding sequences in the EGFP interruption cell model. The VNEQ mutant was called evoCas9 (evolved Cas9).
EvoCas9 activity targeting endogenous loci
[0092] The previous findings were then further validated by targeting endogenous loci. A group of genomic target sites
Petition 870190078259, of 8/13/2019, p. 39/85
31/57 previously tested was thus selected in order to compare the cleavage activity of evoCas9 with that of wild type SpCas9 at each locus. In addition, SpCas9-HFl was also introduced in the comparison as an additional reference. After transfection into 293T cells of each SpCas9 variant together with RNAssg targeting the different loci, indel formation was analyzed using the Tracking of Indels by Decomposition (TIDE) software package in amplicons sequenced by Sanger, with respect to each target site ( Brinkman EK et al., Nucleic Acids Res. 2014, 42 (22): el68). For most loci, no major difference in targeting efficiency was observed between wild-type SpCas9 and evoCas9, with the latter being generally slightly less active with an overall average activity that is 80% of that of the wild-type protein (Fig. 7a and Fig. 7b). For a target site, the ZSCAN2 locus, very little cleavage efficiency was observed, with no obvious explanation for such behavior (Fig. 7a). The SpCas9-HFl variant showed less complete cleavage efficiency, with an average global activity that is 60% compared to the wild type (Fig. 7a and Fig. 7b). This is not in accordance with the previously published observations (Kleinstiver BP et al., Nature. 2016, 529 (7587): 490-5), and it is possible to speculate that this discrepancy may be due to different experimental procedures. These data demonstrate that evoCas9 maintains activity levels in the almost wild type target against a panel of endogenous loci, surpassing the SpCas9-HFl variant previously reported in the experimental conditions tested.
EvoCas9 off-target activity assessment
[0093] Along with the activity directed at the target sites, the specificity of evoCas9 was assessed by checking the editing rate at two previously validated off-target sites, associated with editing at two loci: FANCF site 2 and CCR5 spll. The Cas9 edition of these loci generates interest, since the off-target associated with FANCF site 2 was a
Petition 870190078259, of 8/13/2019, p. 40/85
32/57 of the few non-repetitive sites that SpCas9-HFl was unable to distinguish from the site at the specific target, while the CCR5spll locus, which lavors its therapeutic application in the treatment of AIDS, correlates with off-target cleavage highly homologous CCR2 gene. After transient infection in 293T cells, indel formation in these two off-target loci was measured using TIDE, which reveals a significant decrease in cleavage in cells expressing evoCas9 when compared to cells transfected with wild type SpCas9 (Fig. 8a). In addition, the calculation of on-target / off-target ratios for wild-type SpCas9, evoCas9 and SpCas9-HFl confirmed that the variant of the invention was able to outperform its competitors at these two loci (Fig. 8b). The combined cleavage of the CCR5spll locus and its off-target in the CCR2 gene generates a chromosomal elimination of approximately 16 kilobases (outlined in Fig. 8c). The frequency of this chromosomal rearrangement was measured by semiquantitative PCR in cells transfected with wild-type SpCas9, evoCas9 or SpCas9-HFl, together with the RNAsg that targets the CCR5 locus. Although the translocation event is particularly evident in cells edited by wild-type SpCas9, a strong reduction in the amount of elimination at levels hardly detected was observed both in the presence of SpCas9-HFl and evoCas9, with the latter further reducing the measured elimination to almost twice, with respect to the previous one (Fig. 8c). [0094] Next, the ability of evoCas9 to prevent unwanted genomic cleavages was investigated by performing sequentially deep targeted at a selected set of off-target sites, associated with editing on the VEGFA 3 site and EMX1-K genomic sites. All chosen sites were shown to be previously edited together with the target locus (Kleinstiver BP, et al., Nature. 2015, 523 (7561): 481-5). The advantage of the amplicon sequencing approach is the possibility of simultaneously evaluating multiple targets with high coverage, in order to detect even editing events
Petition 870190078259, of 8/13/2019, p. 41/85
33/57 not very abundant. The sequencing analysis data demonstrated that, while maintaining a lot of activity on the target in both genomic loci, evoCas9 was distinguished by background editing levels in most of the tested off-target sites (Figs. 9a and 9b). The first site outside the target of the VEGFA 3 site (VEGFA3-0T1) was the only locus where the evoCas9 editing activity appeared above the bottom (Fig. 9b). However, it must be considered that the same locus is edited almost like the target site by wild-type SpCas9, and that the previously reported SpCas9-HFl variant was unable to completely suppress the nonspecific cleavage of this sequence (Kleinstiver BP et al. Nature ., 2016, 529 (7587): 490-5). It is speculated that these results can be explained by the highly repetitive nature of its particular locus. In relation to the four sites outside the target of the VEGFA site 3 (VEGFA3-OT1, -OT4, -OT5, -OT7), significantly higher background editing rates (Fig. 9b) were revealed, probably due to peculiar chromatin characteristics which is more fragile and thus prone to accumulate mutations.
[0095] Altogether, these data indicate that evoCas9 significantly decreases unwanted genomic cleavages to undetectable levels for most tested off-target sites. In addition, side-by-side comparisons with the previously published SpCas9-HFl variant for selected off-target sites demonstrated a greater ability to discriminate incompatible sites.
Specificity of the complete genome of evoCas9
[0096] The analysis of evoCas9 off-target activity at one level of the complete genome has been expanded using the previously established GUIDE-seq technique (Tsai SQ et al., Nat Biotechnol. 2015, 33 (2): 187-97). This approach is based on the integration of a 34 bp oligonucleotide tag at the sites that was cut by Cas9, in order to allow its capture for the next generation library preparation and sequencing. This
Petition 870190078259, of 8/13/2019, p. 42/85
34/57 In this way, it is possible to identify in an impartial way a collection of novel genomic sites associated with a particular guide RNA, which are targeted by Cas9. The GUIDE-seq analysis was performed to analyze the off-target sites associated with the editing of VEGFA site 2 locus, which is highly repetitive, and has been shown to generate several unwanted cleavages in the cell genome. In addition, previous reports (Kleinstiver BP et al., Nature. 2016, 529 (7587): 490-5) indicated that some of the off-target detected will still be cleaved by the high-fidelity SpCas9-HFl variant. The GUIDE-seq libraries were thus generated from genomic DNA from 293T cells transfected with both wild-type SpCas9 and evoCas9, along with VEGFA site 2 RNAsg and the double-stranded bait oligonucleotide. Sequencing data was analyzed using open source software Pipeline (Tsai SQ et al., Nat Biotechnol. 2016, 34 (5): 483), which reveals 600 different off-target sites for wild type SpCas9, distinguished by 7 or less incompatibilities with the target sequence (Figs. 10a and 10b). Importantly, approximately 100 of these off-target sequences were edited more efficiently than the site on the target, according to the number of readings obtained after GUIDE-seq analysis, which was reported as a good indicator of the current cleavage activity at each site specific (Tsai SQ et al., Nat Biotechnol. 2015, 33 (2): 187-97) (Fig. 10a). When the same analysis was performed in the evoCas9 samples, a total of only 10 sites were detected, most of which shared a high similarity with that in the target and was distinguished in less than five incompatibilities with the VEGFA site 2 locus (Fig. 10a ). Only one off-target emerged from the analysis, showing high frequency cleavage (more than on the target) by evoCas9, and this was probably due to the particular nature of this sequence that differed by only two nucleotides from the intended target, and contained two non-target stretches. disrupted cytosines at the level of each incompatibility
Petition 870190078259, of 8/13/2019, p. 43/85
35/57 (Fig. 10a), possibly allowing the formation of bulge sites to accommodate non-corresponding nucleotides.
[0097] Overall, the previous GUIDE-seq analysis showed that evoCas9 maintains very high specificity at the complete genome level, even when tested using a repetitive target sequence, distinguished by off-target multiples in the cell genome.
Specificity of an evo-dCas9-based transcriptional activator
[0098] An alternative application for Cas9, regardless of its nuclease activity, is the generation of transcriptional activators guided by RNA, fusing a catalytically inactive version of Cas9 (dCas9) to various protein domains capable of stimulating transcription. A transcriptional activator based on VP64 was engineered using a catalytically inactive mutant of evoCas9 (evo-dCas9) and tested side by side with a wild type dCas9-VP64 activator. Transcriptional activation was tested using a reporter system based on an inducible EGFP expression vector, regulated by a TetR-based transactivator, using Tet operator elements integrated in a minimal CMV promoter. The Tet transactivator has been replaced by the Cas9-based transcriptional activator guided by an RNAsg that targets the repeated Tet operator sequences (Fig. 11a). Two different RNAsg on the target that differ only in the presence or absence of an extra 5'-G nucleotide have been designed for the Tet locus operator of the reporter plasmid and three additional incompatible guides based on the same sequence in the target, resulting in either one or two mutations at different positions along the spacer sequence. Lower absolute levels of EGFP expression were observed with evo-dCas9VP64 compared to dCas9-VP64, for both corresponding and incompatible guide RNAs, suggesting stronger binding to the target DNA by wild-type dCas9 (Fig. 11b). However, activation of the fold in the target in relation to the control RNAsg was similar for both wild type and dCas9
Petition 870190078259, of 8/13/2019, p. 44/85
36/57 for evo-dCas9, due to the lower background activation observed with evodCas9. This result is probably due to the lower possibility of evo-Cas9 binding to DNA nonspecifically (Fig. 11c). Interestingly, the increased specificity shown by evo-dCas9-VP64 was modest when compared to dCas9-VP64, suggesting that evoCas9 binds to incompatible targets, although less efficiently, but is then able to complete the cleavage reaction (Fig. 11c ). Overall, these results indicate that evoCas9 can be exploited to build a transcriptional regulator distinguished by lower background activation, although with less absolute activation power, and slightly increased activation fidelity.
Long-term specificity of evoCas9
[0099] Since permanent expression of Cas9 in cells was associated with increased off-target activity, an important issue that was investigated was the long-term behavior of evoCas9 in cells. To solve this point, lentiviral particles were generated in order to obtain stable expression of wild type SpCas9, evoCas9 or SpCas9-HFl together with an RNAsg of interest. To explore a cell model of EGFP knockout similar to the one previously employed, to select variants of high specificity, the experiments were conducted using the same set of RNAssg directed to the EGFP coding sequence, both corresponding perfectly with the locus and containing one or more incompatibilities in different positions of the spacer sequence, acting as well as off-target substitutes. The reporter cell line was transduced with equal amounts of the different lentiviral vectors and cultures were selected over the entire period of the experiments to isolate the transduced population and avoid the possible dilution of editing events within the deadline, produced by the loss of edited cells or the reduced performance of the transduced cells. Similarly, as observed in transient transfection experiments, the decrease in
Petition 870190078259, of 8/13/2019, p. 45/85
37/57 EGFP fluorescence at different time points revealed that wild-type SpCas9 cuts the target sequence with similar efficiency with both perfectly matched and incompatible RNAsg (see Fig. 12a and Fig. 5c). In contrast, both evoCas9 and SpCas9-HFl did not cleave EGFP efficiently using the RNAssg sgGFP1314 and sgGFP1819, both containing double incompatibilities (Fig. 12b-c). Importantly, while the loss of fluorescence was at background levels for evoCas9 samples at all time points, a measurable number of EGFP negative cells, which remained constant over time, was present in cultures transduced with vectors that express SpCas9-HFl (Fig. 12c). Furthermore, when considering the strongest substitute off-target, sgGFP18 containing a single mismatch in a distal PAM position, the behavior of the two variants differed significantly: while SpCas9-HFl was not able to correctly discriminate between corresponding and incompatible RNAsg and cleaved the target locus with similar efficiency, evoCas9 showed an increasing trend of loss of fluorescent cells that reached less than half the level of the target's knockout in 40 days after transduction (Figs. 12b-c). These data suggest that, with careful selection of guide RNAs, the highly specific Cas9 variant of the invention, evoCas9, allows long-term expression of the nuclease with limited or undesired cleavages in the cell genome.
MATERIALS AND METHODS
[00100] Plasmids and constructs. Plasmid p415-GalL-Cas9CYClt was used to express Cas9 in yeast (obtained from Addgene, # 43804) (Di Cario JE, et al., Nucleic Acids Res. 2013, 41 (7): 4336-43). To allow the exact removal of the Reel-II domain by restriction digestion, synonymous mutations were generated by PCR, in order to introduce two restriction sites, Ncol and Nhel, downstream and upstream of the Reel-II domain, respectively ( for primer oligonucleotides, see Table 2 of the
Petition 870190078259, of 8/13/2019, p. 46/85
38/57 appendix). The expression cassette for RNAsg was obtained from plasmid p426-SNR52p-RNAg.CANl.Y-SUP4t (obtained from Addgene, # 43803) (Di Carlo JE, et al., Nucleic Acids Res. 2013, 41 (7): 4336-43). In order to exchange the original spacer sequence for the desired target, an assembly-based PCR strategy was adopted. The 5 'portion of the RNAsg expression cassette was amplified by PCR using the T3 sense primer oligonucleotide (which rings before the SNR52 promoter) and a reverse primer oligonucleotide which immediately rings downstream of the spacer sequence, and which contains a 5' projection which corresponds to the desired target sequence (see Table 2 in the appendix). The same was done for the 3 'fragment of the RNAsg, using the T7 primer oligonucleotide, reverse primer and a felt primer that rings immediately after the spacer sequence, and that contains a 5' antiparallel projection to that previously mentioned. The assembly reaction to obtain the RNAg cassette was prepared by mixing both PCR amplicons and performing a single step of denaturation, progress and extension, followed by an exponential amplification using only the T3 and T7 external primer oligonucleotides. The resulting fragment was then purified on gel and cloned at the blunt end in pRS316 (ATCC), a centromeric plasmid with a small copy number carrying a selectable yeast URA3 marker, pre-digested with SacII / Xhol and blind, generating plasmid pRS316- SNR52p-RNAg.EM-SUP4t.
[00101] For the expression of SpCas9 in mammalian cells, a plasmid derived from pX330-U6-Chimeric_BB-CBhhSpCas9 (obtained from Addgene, # 42230) (Cong L et al., Science. 2013, 339 (6121) : 819-23), where the RNAsg coding cassette was removed, pX-Cas9. The coding sequence of SpCas9 was optimized in human codon and is regulated by a CBh promoter. In addition, two nuclear localization signals (NLS) were added to SpCas9's N and C
Petition 870190078259, of 8/13/2019, p. 47/85
39/57 allow nuclear import and a triple FLAG is positioned at the N-terminal end of the protein to facilitate detection. The plasmid encoding the best Cas9 variants was obtained by sequential directed site mutagenesis, starting from plasmid pX-Cas9. For the expression of previously published and improved SpCas9 mutants, plasmids VP12 (obtained from Addgene, # 72247) (Kleinstiver BP et al., Nature. 2016, 529 (7587): 490-5) and eSpCas9 (ll) (obtained de Addgene, # 71814) (Slaymaker IM et al., Science. 2016, 351 (6268): 84-8) plasmids were used. Desired spacer sequences were cloned as ringed oligonucleotides with appropriate projections into a double Bbsl site, downstream of the constant portion of the guide RNA of a pUC19 plasmid containing an expression cassette directed to the U6 promoter. For experiments involving lentiviral vectors, the lentiCRISPRvl transfer vector (obtained from Addgene, # 49535) (Cong L et al., Science. 2013, 339 (6121): 819-23) was used together with the pCMV packaging vector -delta8.91 (kindly provided by Didier Trono, EPFL, Switzerland) and pMD2.G (obtained from Addgene, # 12259), which encodes the vesicular stomatitis virus (VSVG) glycoprotein to produce viral particles. The lentiCRISPRvl transfer vector contains an expression cassette for a humanized codon version of an N-terminally FLAG-labeled SpCas9, fused by means of a 2A peptide in the puromycin encoding sequence to allow selection of transduced cells. An U6-directed expression cassette transcribes the RNAsg. The ringed oligos that correspond to the desired spacers were cloned into the guide RNA using a double BsmBI site. The lentiCRISPRvl-based vectors that encode the best SpCas9 variants were generated by exchanging part of the SpCas9 coding sequence for a PCR fragment that corresponds to the region of the CDS containing the mutations (for primer oligonucleotides, see Table 2 in the appendix). Plasmid pTRE-GFP was obtained by subcloning the
Petition 870190078259, of 8/13/2019, p. 48/85
40/57 EGFP coding sequence from plasmid pEGFP-N 1 (Clontech) in the pTRE-Tight cloning vector (Clontech). A complete list of target RNA target sites is available in the appendix. All oligonucleotides were obtained from Eurofins Genomics.
[00102] Yeast culture. The yLFM-ICORE yeast strain (generated by one of the parent inventors of the yIG397 parent strain, kindly provided by Richard Iggo) (Jegga AG et al., Proc Natl Acad Sei United States. 2008, 105 (3): 944-9; Tomso DJ et al., Proc Natl Acad Sei United States 2005, 102 (18): 6431-6) was used to generate the reporter yeast strains used in this study. Synthetic minimal media (SD) were used in all yeast experiments (nitrogen based yeast without amino acids 6.7 g / L, L-isoleucine 600 mg / L, L-valine 150 mg / L, L-adenine 200 mg / L, L-arginine 20 mg / L, L-histidine 10 mg / L, Lleucine 100 mg / L, L-lysine 90 mg / L, L-methionine 20 mg / L, L-phenylalanine 50 mg / L, L -treonin 200 g / L, L-tryptophan 20 mg / L, L-uracil 20 mg / L, L-glutamic acid 100 mg / L, L-aspartic acid 200 g / L, L-serine 400 mg / L, D - (+) glucose 20 g / L). Simple amino acids were omitted, according to the experimental setup, when selective medium was required. For the induction of p415-GalL-Cas9-CYClt, 20 g / L of D - (+) - galactose and 10 g / L of D - (+) raffinose were used instead of dextrose. Specific medium for selecting the color of ADE2 mutants was prepared using low concentrations of adenine (5 mg / L). When non-selective medium was required, the rich YPDA medium was used (yeast extract 10 g / L, peptone 20 g / L, D - (+) - Glucose 20 g / L, L-adenine 200 mg / L). All solutions were prepared using ddfUO, sterilized by filter and stored at 4 ° C. The solid media were prepared by sterilization in an autoclave, adding 20 g / L of agar to the solution. All chemicals for preparing yeast media were obtained from Sigma-Aldrich.
[00103] Yeast transformation. The day before the transformation,
Petition 870190078259, of 8/13/2019, p. 49/85
41/57 approximately 1 mm ³ of the desired yeast strain was inoculated in 5 ml of rich medium or selective synthetic medium, and grown overnight at 30 ° C, while stirring at 200 rpm. The next day, 3-5 mL of the culture was inoculated in a total of 30 mL of the same medium and grown at 30 ° C at 200 rpm for an additional 2-4 hours. The cells were then collected by centrifugation at 2,000 xg for 2 ', washed in 30 ml of ddH2O, centrifuged again at 2,000 xg for 2' and resuspended in 10 ml of LiAc / TE IX (0.1 M lithium acetate, and 10 mM Tris, 1 mM EDTA, pH 7.5). The solution was centrifuged again at 2,000 xg for 2 'and resuspended in an appropriate volume of LiAc / TE IX (100 mg of yeast precipitate in 500 pL). The transformation mixture contained 500 ng of plasmid DNA, 5 pL of carrier salmon sperm DNA (approximately Ipg, Sigma-Aldrich) previously sheared by sonication and boiled at 100 ° C for 10 ', 50 pL of yeast culture again suspended and 300 pL of polyethylene glycol (PEG), 500 g / L with a molecular weight of -36,500 (Sigma-Aldrich) diluted in LiAc / TE IX. After vortexing, the transformation mixture was placed for 30 'at 30 ° C and then heated by thermal shock using a dry bath for 30' at 42 ° C. The cells were then centrifuged at 3,000 xg for 3 ', resuspended in 5 mL of the appropriate SD selective medium or plated directly on selective SD agarose plates and incubated at 30 ° C. To assess the frequency of spontaneous reversal, after transformation with p415-GalL-Cas9-CYClt, cells were grown in selective medium for 24 hours. The cell concentration was then evaluated by measuring ODooo and 1000 cells were plated on reduced leucine (SD1) selective plates, or 10 ⁶ cells were spread on additionally reduced adenine (SDla), tryptophan (SDlt) plates, to evaluate the number of reverse mutations.
[00104] colony PCR for yeast. Colony PCRs were performed by suspending approximately 1 mm ³ of yeast colony
Petition 870190078259, of 8/13/2019, p. 50/85
42/57 in 49 pL of ddH ₂ O. 1 μΕ of liticase (10,000 U / ml, Sigma-Aldrich) was added to digest the cell wall and the suspension was then incubated at 30 ° C for 30 '. The cells were precipitated, the supernatant was removed and the dry precipitate was boiled for 10 'at 100 ° C. The precipitate was then resuspended in 50 pL of ddH ₂ O and 5 μΕ were used as a template in the PCR reaction, using Phusion high fidelity DNA polymerase (Thermo Scientific).
[00105] Recovery of plasmid DNA from yeast. In order to isolate the yeast Cas9 mutant plasmids, isolated colonies were grown overnight at 30 ° C, with shaking at 200 rpm, in 5 mL of SD medium without leucine (SD1) to select the presence of plasmid p415GalL-Cas9 -CYClt, while relaxing the selection on the guide RNA plasmid to induce its dilution and loss. The next day, the cells were collected by centrifugation for 5 'at 5,000 xg and resuspended in 250 pL of Al buffer (NucleoSpin plasmid, Macherey-Nagel) containing 0.1 mg / mL RNase A. The cells were then mechanically lysed by adding 100 pL glass beads washed with acid (Sigma-Aldrich) and vortexing continuously for 5 '. Plasmid DNA was then recovered from the supernatant using standard Miniprep silica columns, following the manufacturer's instructions. The DNA was eluted in 30 pL of 10 mM TrisHCl pH 8.5. The eluted DNA was digested with the enzymes Ncol and Nhel (New England BioLabs) to eliminate the RNAsg vector, in order to avoid contamination from the last plasmids, which are also selectable through resistance to ampicillin. After digestion, 10 pL were transformed into chemically competent E. coli. The recovered plasmids were then digested to verify their identity, and then sequenced by Sanger to identify the mutations introduced in the Reel-II domain.
[00106] Assembly of modified TRP1 and ADE2 genomic cassettes. DNA cassettes used to engineer genomic loci
Petition 870190078259, of 8/13/2019, p. 51/85
43/57
ADE2 (ADE2-0ffl, ADE2-Off2, ADE2-Off3 and ADE2-Off4) and TRP1 (TRP1Em) were built using a similar strategy. Two different colony PCRs were performed to amplify the two halves of each wild type locus separately. The first employed a primer oligonucleotide felt downstream of the CDS gene and a reverse primer oligonucleotide projection containing target sequence 4 on target or off target, followed by the restriction sites Kpnl or BamHI, respectively (see table 3 in the appendix). All reverse primer oligonucleotides contained a stop codon before the target / off target sequence to ensure protein truncation. The second half of the cassette was assembled using a reverse primer oligonucleotide that rings upstream of the coding sequences ADE2 and TRP1, and a sense primer oligonucleotide that rings 100 bp before the reverse primer oligonucleotide used to construct the first half of the cassette. Thus, when the two parts were joined together, the final construct contained a region of long homology of 100 bp downstream and upstream of the target / off target sequences. In addition, these sense primer oligonucleotides contained the same restriction site as the reverse primer oligonucleotide of the corresponding first half of the cassette. The TRP1 and ADE2 fragments were assembled by ligating the two halves digested with Kpnl or BamHI (New England BioLabs) in this way. The products were separated on an agarose gel to remove homologous derived fragments. The final cassette was enriched by PCR using the most external oligonucleotides and transformed directly into yeast.
[00107] Generation of reporter strains of yeast. The perfect delitto approach allows the genetic targeting of specific loci with the practicality of a general selection system through the exploration of homology directed to the repair mechanism, which is particularly efficient in yeast (Stuckey S and Storici F, Methods Enzymol. 2013,
Petition 870190078259, of 8/13/2019, p. 52/85
44/57
533: 103-31). The first step consists of inserting a selectable I-Scel reporter counter (CORE-I-Scel) into the locus of specific interest. The cassette contains a recognition site for I-Scel, as well as the coding sequence for the endonuclease itself in the control of the galactose-inducible GAL1 promoter, the kanMX4 resistance gene (G418) and the URA3 counter-selectable marker gene from Kluyveromyces lactis (K1URA3 ). The CORE-I-Scel cassette was amplified with primer oligonucleotides containing specific projections for the ADE2 and TRP1 loci (see table 3 in the appendix). Each locus was edited sequentially, following the same procedure, starting from the ADE2 locus. 500 ng of the locus-specific CORE-I-Scel cassette were transformed into yeast, and the cells were plated on YPDA plates and incubated at 30 ° C overnight. The next day the colonies were plated in replication in YPDA media containing 200 pg / mL of G418 (Invivogen). The resistant colonies were selected for satisfactory insertion of the cassette in the desired locus by colony PCR using primers that anneal in the flanking genomic sequences in the integration site and in the cassette. The CORE-I-Scel cassette integrated in the targeted locus was then exchanged for the final edited sequence (TRPl-in, ADE2-Offl, ADE2-Off2, ADE2-Off3 and ADE2-Off4), generating a total of four different yeast strains, distinguished by the same sequence on the target and four different off-target. The appropriate intermediate yeast strain containing the target CORE-I-Scel cassette was inoculated overnight in 5mL of YPDA. The following day, before transformation, the inoculum was resuspended in 30 ml of synthetic medium containing galactose and raffinose instead of dextrose (SRG). This step is essential to induce transcription of the endonuclease I-Scel that cuts its target site located on the CORE cassette. This DSB increases the normal frequency of HR-directed repair events, favoring the replacement of the cassette by
Petition 870190078259, of 8/13/2019, p. 53/85
45/57 new desired sequence. After 4 hours in SRG, the yeast was transformed with 500 ng of the HR mold containing the desired sequence following the standard transformation protocol. The transformants were then plated in SD containing 60 mg / L of uracil and 1 g / L of 5-fluororotic acid (5-FOA) (Toronto Research Chemicals). 5-FOA in the presence of orotidine 5'-phosphate decarboxylase (encoded by K1URA3) is converted to fluorouracil, which is a potent inhibitor of thymidylate synthase. The colonies resistant to 5-FOA were then plated in replication in YPDA and YPDA supplemented with G418 to further select in relation to the loss of the CORE cassette. By comparing the two replica plates, it is possible to select colonies resistant to and sensitive to G418 that correspond to the positive clones. Colony PCRs, performed using genomic primer oligonucleotides that annoy downstream and upstream of the entire genomic locus, were analyzed by Sanger sequencing to confirm the edited locus sequence. The recently generated yeast strains containing the modified TRP1 and ADE2 loci were named yACMOoffl, yACMO-off2, yACMO-off3 and yACMO-off4, distinguished by a target sequence selected at the TRP1 locus and four different off-target sequences at the ADE2 locus, each containing a single incompatibility with respect to the target sequence in a position that is more PAM-proximal to off 1 and more PAM-distant to off4 (see table 4 in the appendix).
[00108] Reading the yeast test. The ADE2 and TRP1 genes are key enzymes in the metabolic pathways that lead to the production of adenine and tryptophan, and for this reason their knockout eliminates the yeast's ability to grow in a reduced environment of the two related nutrients. The yACMO yeast strains generated in this study are deficient in relation to TRP1 and ADE2 activity, unless Cas9 cuts the target sequence that interrupts each coding sequence: mediated recombination that rings the single strand
Petition 870190078259, of 8/13/2019, p. 54/85
46/57 between the two regions of 100 bp homology on both sides of the target sites ensures the reconstitution of the wild type locus. A selection based on selection by auxotrophy can then be used to assess Cas9 cleavage activity at the two genomic loci, evaluating so many targeted and untargeted target events. After transformation with p415-GalLCas9-CYClt and pRS316-SNR52p-RNAg.EM-SUP4t, the cells were grown in synthetic medium without leucine and uracil (SDlu) for 4 hours before an overnight induction in medium containing galactose ( SRGlu). The cells were then plated in equal numbers on SDlu plates to measure the total number of transformants and on reduced tryptophan and low adenine SDlu plates (SD fights) to distinguish colonies in which Cas9 cleaved only the sequences in the target or also off-target. In particular, during observation, different phenotypes of the SDluta.s reading plate may be present: the lack of growth indicates the absence of editing of the locus TRP1 (TRP17ADE2 ^{+ /} ); the growth of a red colony (TRPU / ADE2) indicates editing only at the TRP1 locus, with no off-target activity detected; the growth of a white colony (TRP1 ⁺ / ADE2 ⁺ ) indicates editing of both the TRP1 and ADE2 loci, detecting off-target cleavages. The typical red pigmentation of the colony is determined by the accumulation in the cell vacuole of an intermediate in the synthetic biosphere of adenine, generated by the blockade in the level of the ADE2 gene product. Comparing the total number of colonies obtained in SDlu and in SD fights, it is possible to evaluate the efficiency of cleavage on the target, although quantifying the percentage of red and white colonies on the SD fights plate, an estimate of the specificity of Cas9 activity in relation to the sequence can be obtained. off target tested.
[00109] Selection of yeast for SpCas9 mutants. The mutant library was generated by error-prone PCR (PCRep) using the GeneMorph II kit (Agilent). Following the manufacturer's instructions, the amount
Petition 870190078259, of 8/13/2019, p. 55/85
47/57 initial template DNA (p415-GalL-Cas9-CYClt) and the number of cycles were adjusted to obtain an average of 5 mutations per kilobase. 50-bp long primer oligonucleotides were selected to annex 150 bp downstream and upstream of the REC1-II coding sequence (see table 5 in the appendix). The PCR library was assembled directly in vivo by cotransformation of the amplicon cluster mutagenized with plasmid p415-GalL-Cas9-CYClt, previously digested with Ncol and Nhel (New England BioLabs) to remove the REC1-II domain, with a reason 3: 1 insertion / plasmid. The two 150 bp homology regions at both ends of the amplicons were used by yeast to repair the digested plasmid by homologous recombination, thus incorporating the mutagenized portion. Clones containing mutations in these 150bp flanking regions were probably selected negatively during this in vivo assembly step, due to the loss of complete homology. Despite this, these mutations are outside the region of interest (the REC1-II domain). The mutagenic library was selected concurrently with its assembly by cotransformation of the fragments in the yeast strain yACMO-off4, which stably expresses an RNAsg corresponding to the target sequence contained in the TRP1 locus. After transformation, the culture was grown overnight in SD medium without uracil and leucine (SDlu, to select cells that carry both plasmids that express RNAsg and Cas9) to allow recovery and correction of recombination. The following day, Cas9 expression was induced by growing the culture in a medium containing galactose (SRGlu) for 5 hours, before plating on several selective plates without tryptophan and containing a low concentration of adenine (SDluta.s), to distinguish colonies according to with the editing status of the TRP1 and ADE2 loci. After 48 hours, TRP1VADE2 'colonies (red) were streaked on a selective plate with little adenine and no tryptophan, containing galactose and raffinose (SRGlutas), to maintain expression
Petition 870190078259, of 8/13/2019, p. 56/85
48/57
Constitutively induced and force the generation of off-target cleavages. After another 48 hours of incubation, the plasmids expressing Cas9 were extracted from the redest streaks, which correspond to the colonies in which Cas9 cleaved only the site on the target, and the mutations were distinguished by Sanger sequencing.
[00110] Yeast colony color analysis and quantification. All plate images were acquired with a Canon EOS HOOD (1/60, f / 9.0 and ISO 800) and analyzed with OpenCFU (Geissmann Q, PLoS One. 2013; 8 (2): e54072). For all images an inverted limit (value = 2) was used with a radius between 8 and 50 pixels. The discrimination between white and red colonies was calculated by computing the average signal on the RGB channels and adjusting a manual limit that exactly distinguishes between red and white colonies in each experiment.
[00111] Mammalian cells and transfections. 293T / 17 cells were obtained from the American Type Culture Collection (obtained from the ATCC) and were grown in Dulbecco's modified Eagle's medium (DMEM; Life Technologies), supplemented with 10% fetal bovine serum (FCS; Life Technologies) and antibiotics ( PenStrep, Life Technologies). 293multiGFP cells were generated by stable transfection with pEGFP-IRESpuromycin and selected with 1 pg / ml puromycin. 293blastEGFP were obtained by low MOI coinfection of HEK293T cells with the EGFP-expressing lentiviral vector pAIB-GFP, followed by clonal selection with 5 pg / mL blasticidine. For transfection, 1 x 10 ⁵ 293multiGFP or 293T cells / well were seeded in 24-well plates and transfected the next day using TransIT-LTl (Minis Bio), according to the manufacturer's protocol, using 400-750 ng of plasmids that express Cas9 and 200-250 ng of plasmids expressing RNAsg. For transient transfection experiments involving EGFP expression, 100 ng of the plasmid pEGFPN1 was used. To determine the level of EGFP misregulation by
Petition 870190078259, of 8/13/2019, p. 57/85
49/57
Cas9 after transfection in 293multiGFP, cells were collected 7 days after transfection and were analyzed by flow cytometry using a FACSCanto (BD Biosciences).
[00112] Production of lentiviral vector and transductions. Lentiviral particles were produced by sowing 4 χ 10 ⁶ 293T cells in a 10 cm dish. The next day, the plates were transfected with 10 pg of each transfer vector based on lentiCRISPR (Cong L et al., Science. 2013, 339 (6121): 819-23), along with 6.5 pg of vector of pCMVdeltaR8.91 package and 3.5 pg of pMD2.G, using the polyethyleneimine (PEI) method. After an overnight incubation, the medium was replaced with fresh complete DMEM and after 48 hours the supernatant containing the viral particles was collected, centrifuged quickly at 500 xg for 5 minutes and filtered through a 0.45 pm PES filter. . Quantification of vector titrations was performed using the SG-PERT method (Pizzato M et al., J Virol Methods. 2009, 156 (1-2): 1-7). Vector stocks were kept at -80 ° C for future use.
[00113] For transductions, 10 ⁵ 293blastGFP cells were seeded in a 24-well plate, and the next day they were transduced with 0.4 reverse transcriptase (RTU) units / well from each vector centrifuging at 1,600 xg, 16 ° C, for 2 hours. After an overnight incubation, the viral supernatant was removed and the cells were kept in culture for a total of 48 hours before adding 0.5 pg / ml of puromycin selection, which was maintained throughout the experiment. To determine the level of EGFP infrarregulation by Cas9 after infection, 293blastGFP cells were collected at the indicated time points after transduction, and were analyzed by flow cytometry using a FACSCanto (BD Biosciences).
[00114] Detection of genomic mutations induced by Cas9. Genomic DNA was obtained 7 days after transfection, using the QuickExtract DNA extraction solution (Epicenter). PCR reactions for
Petition 870190078259, of 8/13/2019, p. 58/85
50/57 amplifying the genomic loci were performed using Phusion high fidelity DNA polymerase (Thermo Fisher). The samples were amplified using the oligos listed in table 8 of the appendix. The purified PCR products were analyzed by sequencing and applying the TIDE tool (Brinkman EK et al., Nucleic Acids Res. 2014, 42 (22): el68). To quantify the CCR2-CCR5 chromosomal elimination, a semiquantitative PCR approach was configured using primers that flank the site on the CCR5 target and the locus outside the CCR2 target (Table 8 in the appendix). The number of PCR cycles was modulated in order to reach the amplification plateau. Quantifications were obtained by performing densitometric analyzes using the ImageJ software, and exploring the FANCF genomic locus as an internal normalizer.
[00115] Western blots. The cells were lysed in NEHN buffer (20 mM HEPES pH 7.5, 300 mM NaCl, NP400.5%, NaCl, 1 mM EDTA, 20% glycerol supplemented with 1% protease inhibitor cocktail (Pierce)). The cell extracts were separated by SDS-PAGE using the PageRuler Plus protein standards as the standard molecular weight markers (Thermo Fisher Scientific). After electrophoresis, the samples were transferred to 0.22 pm PVDF membranes (GE Healthcare). The membranes were incubated with mouse anti-FLAG (Sigma) to detect SpCas9 and the different high-fidelity variants, with mouse anti-atubulin (Sigma) for load control and with conjugated goat anti-mouse (KPL) secondary antibodies with HRP suitable for ECL detection. The images were acquired using the UVItec Alliance detection system.
[00116] Targeted deep sequencing. The off-target sites selected for the VEGFA3 and EMX1 genomic loci, along with their on the related target, were amplified using the high fidelity polymerase Phusion (Thermo Scientific) or EuroTaq polymerase (Euroclone), from
Petition 870190078259, of 8/13/2019, p. 59/85
51/57
293T genomic DNA extracted 7 days after transfection with wild-type SpCas9 or evoCas9, along with RNAssg that targets the EMX1 and VEGFA3 loci, or an empty pUC vector. Amplicons outside the target were grouped in almost equimolar concentrations before purification and indexing. The libraries were indexed by PCR using Nextera (Illumina) indices, quantified with the Qubit high sensitivity DNAds assay kit (Invitrogen), grouped according to the number of targets and sequenced in an Illumina Miseq system using a V3 reagent kit Miseq - 150 cycles (single reading of 150 bp). The complete list of primer oligonucleotides used to generate the amplicons is reported in table 7 in the appendix.
[00117] A reference genome was constructed using Picard (http://broadinstitute.github.io/picard) and samtools (Li H at al., Bioinformatics. 2009, 25 (16): 2078-9) from the sequences of DNA from regions considered on target / off target. The raw sequencing data (FASTQ files) were mapped against the reference genome created using BWA-MEM (Li H and Durbin R, Bioinformatics. 2010, 26 (5): 589-95) with standard parameters, and the alignment files results were classified using SAMtools. Only readings with a mapping quality above or equal to 30 were maintained. The presence of indels in each reading for each region considered was determined by searching for indels of 1 bp in size directly adjacent to the predicted cleavage site or indels of size> = 2 bp that overlap the flanking regions of size of 5 bp around the site predicted cleavage.
[00118] GUIDE-seq experiments and data analysis. GUIDE-seq was carried out in the manner previously described (Bolukbasi MF et al., Nat Methods. 2015,12 (12): 1150-6) with few modifications. Briefly, 2 χ 10 ⁵ 293T cells were transfected with 750 ng of a Cas9 expression plasmid, along with 250 ng of plasmid encoding RNAsg, or a
Petition 870190078259, of 8/13/2019, p. 60/85
52/57 empty plasmid pUC19 and 10 pmol of dsODN bait containing phosphorothioate bonds at both ends (designed according to the original GUIDE-seq protocol) using Lipofectamine 3000 transfection reagent (Invitrogen). Three days after transfection, genomic DNA was extracted using the DNeasy Blood and Tissue kit (Qiagen) following the manufacturer's instructions, and sheared to an average size of 500 bp with the Bioruptor Pico (Diagenode) sonication device. Library preparations were performed with the original adapters and primers according to previous work (Tsai SQ et al., Nat Biotechnol. 2015, 33 (2): 187-97). The libraries were quantified with the Qubit high sensitivity DNAds assay kit (Invitrogen), and sequenced with the MiSeq sequencing system (Illumina) using an Illumina Miseq reagent V2 kit - 300 cycles (2 x 150 bp paired).
[00119] The raw sequencing data (FASTQ files) were analyzed using the GUIDE-seq computational pipeline (Tsai SQ et al., Nat Biotechnol. 2015, 33 (2): 187-97). After demultiplexing, putative PCR duplicates were consolidated into single readings. Consolidated readings were mapped with the human reference genome GrCh37, using BWAMEM (Li H and Durbin R, Bioinformatics. 2010, 26 (5): 589-95): readings with mapping quality less than 50 were filtered. By identifying the genomic regions that integrate double-stranded oligodeoxynucleotide (ODNsds) in aligned data, the RGN sites were maintained if a maximum of eight incompatibilities against the target were present, and if they are absent in the background controls. The visualization of aligned off-target sites is available as a color-coded sequence grid.
Appendix
Table 1. Mutants obtained from yeast selection, in relation to figure 4.
Mutant Amino acid substitutions A0 R403H, N612Y, L651P, K652E, G715S Al R403H, N612Y, L651P, K652E, G715S
Petition 870190078259, of 8/13/2019, p. 61/85
53/57
A2 W659R, R661L A3 E540Q, L607P A4 R400H, Y450S A5 T472A, P475H, A488V A6 N407P, F498I, P509L A7 D406Y A8 A488V, D605V, R629G, T657A A9 S487Y, N504S, E573D A10 K377E, L598P, L651H All T496A, N609D, A728G A12 Y450H, F553L, Q716H Bl K484M, Q695H, Q712R B2 L683P B3 P449S, F704S B4 S675C, Q695L B5 W464L B6 I473F, D550N, Q739E B7 A421V, R661W B8 M495V, K526N, S541P, K562E B9 D406V, E523K BIO N407H, K637N, N690I Bll M495V, K526N, S541P, K562E B12 I679V, H723L B13 N522K, G658E B14 L423P, M465R, Y515N, K673M B15 R654H, R691Q, H698Q Cl L683P C2 T474A C3 L683P C4 L683P C5 W476R, L738P C6 W476R, L738P C7 W476R, L738P C8 W476R C9 L683P CIO L683P Cll L683P C12 L683P C13 K526E C14 F405L, F518E, E651P, I724V C15 K526E C16 E470D, I548V, A589T, Q695H C17 E470D, I548V, A589T, Q695H C18 E470D, I548V, A589T, Q695H C19 Y450N, H698P, Q739K C20 K526E C21 F405E, F518E, E651P, I724V C22 F405E, F518E, E651P, I724V C23 D397E, Y430C, E666P C24 E380 *, I473V C25 Reading frame, N522S, K646R, D686V C26 Reading frame, N522S, K646R, D686V C27 Reading frame, N522S, K646R, D686V C28 Reading frame, N522S, K646R, D686V C29 R691E, H721R, I733V C30 Q402R, V561M, Q695H C31 Q402R, V561M, Q695H C32 Q402R, V561M, Q695H C33 F478Y, N522I, E727H
Petition 870190078259, of 8/13/2019, p. 62/85
54/57 | C34 i Reading frame, A640T, Q709L * = stop codon
Table 2. Primer oligonucleotides used to clone plasmid
Name ofoligonucleotide primer String (5 ’-... -3’) Recl-n-Nhel-F CCAGAAAGCACAAGTTGCTAGCCAGGGGGACAGTC (SEQ ID N. 4) Recl-II-Nhel-R GACTGTCCCCCTGGCTAGCAACTTGTGCTTTCTGG (SEQ ID No. 5) Recl-n-NcoI-F CAGCGCACTTTCGACCATGGAAGCATCCCCCA (SEQ ID No. 6) Recl-II-NcoI-R TGGGGGATGCTTCCATGGTCGAAAGTGCGCTG (SEQ ID N. 7) T3-Direction AATTAACCCTCACTAAAGGG (SEQ ID No. 8) T7-Reverso TAATACGACTCACTATAGGG (SEQ ID No. 9) RNAsg-Ontarget-F CTCGTGACCACCCTGACCTAGTTTTAGAGCTAGAAATAGCAA (SEQ ID N. 10) RNAsg-Ontarget-R TAGGTCAGGGTGGTCACGAGGATCATTTATCTTTCACTGCG (SEQ ID N. 11) Apa-ZhangCas-F ACGTGGGCCCTCTGGCCAG (SEQ ID No. 12) Nhe-ZhangCas -R TACGCTAGCTCCCTTTTTCTTTTTTGCCTGG (SEQ ID No. 13) Apa-JoungCas-F ATTAGGGCCCCCTGGCCCGAGGGAAC (SEQ ID No. 14) Spe-JoungCas-R TAATACTAGTGACTTTCCTCTTCTTCTTGGG (SEQ ID No. 15)
Table 3. Primer oligonucleotides used in the yeast reporter cassette construct
Name of the initiator oligonucleotide String (5 ’-... -3’) TRP1-genomic-F CCAAGAGGGAGGGCATTGG (SEQ ID No. 16) TRPlPtl-EM-Kpn-R TGCGGTACCGTAGGTCAGGGTGGTCACGAGTTAGAGGAACTC TTGGTATTCTTGC (SEQ ID N. 17) TRPlPt2-Kpn-F TTAGGTACCGTAATCAACCTAAGGAGGATGTTT (SEQ ID N.18) TRP1-genomic-R TGCTTGCTTTTCAAAAGGCCTG (SEQ ID No. 19) ADE2-genomic-F TGCCTAGTTTCATGAAATTTTAAAGC (SEQ ID No. 20) ADE2Ptl-OFFl-Bam-R CCAGGATCCGGAGGTCAGGGTGGTCACGAGTTAGACGCAAG CATCAATGGTAT (SEQ ID N. 21) ADE2Ptl-OFF2-Bam-R CCAGGATCCGTAGGTAAGGGTGGTCACGAGTTAGACGCAAG CATCAATGGTAT (SEQ ID N. 22) ADE2Ptl-OFF3-Bam-R CCAGGATCCGTAGGTCAGGGCGGTCACGAGTTAGACGCAAG CATCAATGGTAT (SEQ ID N. 23) ADE2Ptl-OFF4-Bam-R CCAGGATCCGTAGGTCAGGGTGGTAACGAGTTAGACGCAAG CATCAATGGTAT (SEQ ID N. 24) ADE2Pt2-Bam-F ATTAGGATCCTGGTGTGGAAATGTTCTATTTAG (SEQ ID N. 25) ADE2-genomic-R GTAATCATAACAAAGCCTAAAAAATAG (SEQ ID No. 26) TRP1-CORE-F TATTGAGCACGTGAGTATACGTGATTAAGCACACAAAGGCAG CTTGGAGTTAGGGATAACAGGGTAATTTGGATGGACGCAAAG AAGT (SEQ ID N. 27) TRP1-CORE-R TGCAGGCAAGTGCACAAACAATACTTAAATAAATACTACTCAGTAATAACTTCGTACGCTGCAGGTCGAC (SEQ ID No. 28) ADE2-CORE-F CCTACTATAACAATCAAGAAAAACAAGAAAATCGGACAAAA CAATCAAGTTAGGGATAACAGGGTAATTTGGATGGACGCAA AGAAGT (SEQ ID N. 29) ADE2-CORE-R ATATCATTTTATAATTATTTGCTGTACAAGTATATCAATAAACTTATATATTCGTACGCTGCAGGTCGAC (SEQ ID No. 30)
Petition 870190078259, of 8/13/2019, p. 63/85
55/57
Table 4. On- and off-target sites used to generate yACMO strains
Target name String (5'- ... -3 ', with lower case PAM), incompatibility in bold TRPl-on CTCGTGACCACCCTGACCTAcgg (SEQ ID No. 31) ADE2-offl CTCGTGACCACCCTGACCTCcgg (SEQ ID No. 32) ADE2-off2 / CTCGTGACCACCCTTACCTAcgg (SEQ ID No. 33) ADE2-off3 CTCGTGACCGCCCTGACCTAcgg (SEQ ID No. 34) ADE2-off4 CTCGTTACCACCCTGACCTAcgg (SEQ ID No. 35)
Table 5. Error prone PCR primer oligonucleotides
Name of the initiator oligonucleotide String (5 ’-... -3’) PCRep-F GTCTAAAAATGGCTACGCCGGATACATTGACGGCGGAGCAAGCCA GGAGG (SEQ ID N. 36) PCRep-R TCTCGGGCCATCTCGATAACGATATTCTCGGGCTTATGCCTTCCCA TTAC (SEQ ID No. 37)
Table 6. Spacing sequences used to prepare RNAssg for reporter trials _____________________________________________________________________
Target name Spacer string (5 ’-... -3’) GFPon GGGCACGGGCAGCTTGCCGG (SEQ ID No. 38) GFP1314 GGGCACCCGCAGCTTGCCGG (SEQ ID No. 39) GFP1819 GCCCACGGGCAGCTTGCCGG (SEQ ID No. 40) GFP18 GGCCACGGGCAGCTTGCCGG (SEQ ID No. 41) PFM site 2 GTCGCCCTCGAACTTCACCT (SEQ ID No. 42) PFM site 14 GAAGGGCATCGACTTCAAGG (SEQ ID No. 43) PFM site 16 GCTGAAGCACTGCACGCCGT (SEQ ID No. 44) PFM site 18 GACCAGGATGGGCACCACCC (SEQ ID No. 45) PFM site 20 GAAGTTCGAGGGCGACACCC (SEQ ID No. 46) GFPon-19nt GGCACGGGCAGCTTGCCGG (SEQ ID No. 47) GFPB-18nt GGCAAGCTGCCCGTGCCC (SEQ ID No. 48) GFPW-17nt GTGACCACCCTGACCTA (SEQ ID N. 49) TetO-on GTGATAGAGAACGTATGTCG (SEQ ID N. 50) Ceiling-on + G gGTGATAGAGAACGTATGTCG (SEQ ID N. 51) TetO-off6 GTGATAGAGAACGTCTGTCG (SEQ ID N. 52) TetO-offl314 GTGATACTGAACGTATGTCG (SEQ ID N. 53) TetO-offl819 GACATAGAGAACGTATGTCG (SEQ ID No. 54)
Incomaptible 5'-nucleotides are indicated in lower case. Mutations are indicated in bold.
Table 7. Targeted deep sequencing oligos
Common sense projection: 5’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3 ’(SEQ ID N. 55)
Reverse projection: 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3 ’(SEQ ID N. 56)
Petition 870190078259, of 8/13/2019, p. 64/85
56/57
Locus Target Direction (5 ’-...- 3’) Reverse (5 ’-...- 3’) EMXl-on GAGTCCGAGCAGAAGAAGAAggg (SEQ ID No. 57) CCGGAGGACAAAGTAC AAACGGC (SEQ ID No. 58) AAGCAGCACTCTGCCCTCGTG (SEQ ID No. 59) EMXl-otl GAGTTAGAGCAGAAGAAGAAagg (SEQ ID No. 60) CTTTTATACCATCTTGG GGTTACAG (SEQ ID N. 61) CTAGGAAAGATTAACAG AGAGTCTGAC (SEQ ID N. 62) EMXl-ot2 GAGTCTAAGCAGAAGAAGAAgag (SEQ ID No. 63) CAATGTGCTTCAACCCATCACGGC (SEQ ID No. 64) CCTCTACTTCATTGTACT CAAGGTAAG (SEQ ID N. 65) EMXl-ot3 AAGTCTGAGCACAAGAAGAAtgg (SEQ ID No. 66) TAGTTCTGACATTCCTCCTGAGGG (SEQ ID No. 67) CTCTGTTGTTATTTTTTGGTCAATATCTG (SEQ ID No. 68) EMXl-ot4 GAGTCCTAGCAGGAGAAGAAgag (SEQ ID No. 69) AAAGCCTGGAGGCTGCCAGGT (SEQ ID No. 70) ATCTAGCTGTCCTGTCTCATTGGC (SEQ ID No. 71) EMXl-ot5 GAGGCCGAGCAGAAGAAAGAcgg (SEQ ID No. 72) CAGGAGCCGGGTGGGA G (SEQ ID No. 73) CCTCAGCCTTCCCTCAGCCAC (SEQ ID No. 74) VEGFA3-on GGTGAGTGAGTGTGTGCGTGtgg (SEQ ID No. 75) CTGGGTGAATGGAGCGAGCAG (SEQ ID No. 76) GGAAGGCGGAGAGCCGGACA (SEQ ID No. 77) VEGFA3otl AGTGAGTGAGTGTGTGTGTGggg (SEQ ID No. 78) GAAGGGGAGGGGGAAGTCACC (SEQ ID No. 79) CGTGCGTGCCGCCGTTGATC (SEQ ID No. 80) VEGFA3ot2 TGTGGGTGAGTGTGTGCGTGagg (SEQ ID No. 81) TCTGTCACCACACAGTT ACCACC (SEQ ID N. 82) GTAGTTGCCTGGGGATG GGGTATG (SEQ ID N. 83) VEGFA3ot3 GCTGAGTGAGTGTATGCGTGtgg (SEQ ID No. 84) CACCTGGCCCATTTCTC CTTTGAGG (SEQ ID No. 85) TGGGGACAGCATGTGCA AGCCACA (SEQ ID No. 86) VEGFA3ot4 GGTGAGTGAGTGTGTGTGTGagg (SEQ ID No. 87) GGACCCCTCTGACAGAC TGCA (SEQ ID No. 88) CACACACCCTCACATACCCTCAC (SEQ ID No. 89) VEGFA3ot5 AGAGAGTGAGTGTGTGCATGagg (SEQ ID No. 90) GGAAGAATGCAAAGGAGAAGCAAGTAC (SEQ ID No. 91) GACCTGGTGGGAGTTGA TTGGATC (SEQ ID N. 92) VEGFA3-Ot6 AGTGTGTGAGTGTGTGCGTGtgg (SEQ ID No. 93) CCTTGGGAATCTATCTTGAATAGGCCT (SEQ ID No. 94) GACACCCCACACACTCTCATGC (SEQ ID No. 95) VEGFA3ot7 TGTGAGTAAGTGTGTGTGTGtgg (SEQ ID No. 96) CCTAAGCTGTATGTGAG TCCCTGA (SEQ ID No. 97) CTGTTTTGCTAAGAGATG ATTAGATGGTC (SEQ ID N. 98) VEGFA3ot8 GTTGAGTGAATGTGTGCGTGagg (SEQ ID No. 99) GCCCTCTCCGGAAGTGCCTTG (SEQ ID No. 100) GAAGGGTTGGTTTGGAAGGCTGTC (SEQ ID N.101) VEGFA3ot9 GGTGAGTGAGTGCGTGCGGGtgg (SEQ ID No. 102) CCACAGGAATTTGAAGT CCGTGCT (SEQ ID No. 103) ACPCACTCCACCCATACACAC (SEQ ID No. 104) VEGFA3otlO AGCGAGTGGGTGTGTGCGTGggg (SEQ ID No. 105) GACGTCTGGGTCCCGAGCAGT (SEQ ID No. 106) GGCCGTCAGTCGGTCCCGA (SEQ ID No. 107) VEGFA3otll TGTGAGTGAGTGTGTGCGTGtga (SEQ ID No. 108) GGAGGGTTGAACTGTG ACAGAACTG (SEQ ID N. 109) TGAGTATGTGTGAGTGA GAGTGTGCA (SEQ ID N. 110) VEGFA3otl2 AGTGTGTGAGTGTGTGCGTGagg (SEQ ID No. 111) GATCCTTAGGCGTGCGTGTGC (SEQ ID No. 112) CACCGGCACAGTGACACTCAC (SEQ ID No. 113) VEGFA3otl3 TGTGAGTGAGTGTGTGTATGggg (SEQ ID No. 114) AGACCTTCAATGTGGAT GTGCGTG (SEQ ID N. 115) CATAGAGTGTAGCAGATTTCCATAACTTC (SEQ ID No. 116)
Mutations are indicated in bold. PAM are included in lower case.
Table 8. Spacer sequences for genomic targets & oligos for amplification of genomic loci
Petition 870190078259, of 8/13/2019, p. 65/85
57/57
Locus Target Direction (5 ’-...- 3’) Reverse (5 ’-...- 3’) VEGFA3 GGTGAGTGAGTGTGTG CGTGTGG (SEQ ID No. 75) GCATACGTGGGCTCCAACAGGT (SEQ ID No. 117) CCGCAATGAAGGGGAAGCTCGA (SEQ ID No. 118) ZSCAN2 GTGCGGCAAGAGCTTC AGCCGGG (SEQ ID No. 119) GACTGTGGGCAGAGGTTCAGC (SEQ ID No. 120) TGTATACGGGACTTGAC TCAGACC (SEQ ID N. 121) EMX1-K GAGTCCGAGCAGAAGA AGAAGGG (SEQ ID N. 57) CTGCCATCCCCTTCTGTGAATGT (SEQ ID No. 122) GGAATCTACCACCCCAGGCTCT (SEQ ID No. 123) VEGFA2 GACCCCCTCCACCCCGC CTCCGG (SEQ ID No. 124) TCAGCGGACTCACCGGCCAG (SEQ ID No. 125) GCGCCGAGTCGCCACTG CGG (SEQ ID No. 126) FANCF2 GCTGCAGAAGGGATTC CATGAGG (SEQ ID N. 127) GCCAGGCTCTCTTGGAGTGTC (SEQ ID No. 128) AGCATAGCGCCTGGCAT TAATAGG (SEQ ID N. 129) FANCF2-OT1 GCTGCAGAAGGGATTC CAAGAGG (SEQ ID No. 130) CCCGTGAGGTGCTGAG ATTTGAAC (SEQ ID N. 131) CACATGGAGGAGGTGAC GCTG (SEQ ID N. 132) CCR5spll GGTACCTATCGATTGTCAGGAGG (SEQ ID No. 133) ATGCACAGGGTGGAAC AAGATGGA (SEQ ID N. 134) CTAAGCCATGTGCACAA CTCTGAC (SEQ ID N. 135) CCR2 GGTATCTATCGATTGTCAGGAGG (SEQ ID No. 136) CATTGTGGGCTCACTCTGCTGCA (SEQ ID No. 137) CTGAGATGAGCTTTCTG GAGAGTCA (SEQ ID No. 138)
Incompatible 5'-G are indicated in lower case. Mutations are indicated in bold. PAM is included in the target strings.

权利要求:
Claims (28)
[1]
1. Isolated modified Cas9 molecule, characterized by the fact that it comprises at least one mutation located at an amino acid residue position selected from the group consisting of K526, K377,
E387, D397, R400, D406, A421, L423, R424, Q426, Y430, K442, P449,
V452, A456, R457, W464, M465, K468, E470, T474, P475, W476, F478,
K484, S487, A488, T496, F498, L502, N504, K506, P509, F518, N522,
E523, L540, S541,1548, D550, F553, V561, K562, E573, A589, L598, D605, L607, N609, N612, E617, D618, D628, R629, R635, K637, L651, K652,
R654, T657, G658, L666, K673, S675, 1679, L680, L683, N690, R691,
N692, F693, S701, F704, Q712, G715, Q716, H723,1724, L727,1733, L738, Q739; wherein the position of the modified amino acid sequence is identified by reference to the amino acid numbering in the corresponding position of a mature unmodified Cas9 of Streptococcus pyogenes (SpCas9), as identified by SEQ ID NO: 1.
[2]
2. Cas9 modified according to claim 1, characterized by the fact that it comprises at least one mutation at position K526.
[3]
3. Cas9 modified according to claim 2, characterized by the fact that the mutation at position K526 is selected from the group consisting of K526N and K526E.
[4]
4. Cas9 modified according to claim 2 or 3, characterized by the fact that it comprises at least one additional mutation located at an amino acid residue position selected from the group consisting of:
K377, E387, D397, R400, Q402, R403, F405, D406, N407,
A421, L423, R424, Q426, Y430, K442, P449, Y450, V452, A456, R457,
W464, M465, K468, E470, T472, 1473, T474, P475, W476, F478, K484,
S487, A488, M495, T496, N497, F498, L502, N504, K506, P509, Y515,
Petition 870190078259, of 8/13/2019, p. 67/85
2/7
F518, N522, E523, L540, S541,1548, D550, F553, V561, K562, E573, A589, L598, D605, L607, N609, N612, E617, D618, D628, R629, R635, K637,
L651, K652, R654, T657, G658, W659, R661, L666, K673, S675, 1679,
L680, L683, N690, R691, N692, F693, Q695, H698, S701, F704, Q712,
G715, Q716, H721, H723,1724, L727, A728,1733, L738, Q739.
[5]
5. Cas9 modified according to claim 4, characterized by the fact that the at least one additional mutation is in a position selected from the group consisting of Y450, M495, Y515, R661, N690, R691, Q695, H698.
[6]
6. Cas9 modified according to claim 4 or 5, characterized by the fact that at least one additional mutation is selected from the group consisting of:
K377E, E387V, D397E, R400H, Q402R, R403H, F405L, D406Y, D406V, N407P, N407H, A421V, L423P, R424G, Q426R, Y430C, K442N, P449S, Y450A, Y4504, Y450, R457Q, W464L, M465R, K468N, E470D, T472A, I473F, I473V, T474A, P475H, W476R, F478Y, F478V, K484M, S487Y, A488V, M495V, M495T, T496A, N49, P509L, Y515N, F518L, F518I, N522K, N522I, E523K, E523D, L540Q, S541P, I548V, D550N, F553L, V561M, V561A, K562E, E573D, A589T, L598P, N60, N60, N60, N60, N60 E617K, D618N, D628G, R629G, R635G, K637N, L651P, L651H, K652E, R654H, T657A, G658E, W659R, R661A, R661W, R661L, R661Q, R661S, L666P, K6, 666, R691Q, R691L, N692I, F693Y, Q695A, Q695H, Q695L, H698Q, H698P, S701F, F704S, Q712R, G715S, Q716H, H721R, H723L, I724V, L727H, A7287, A728,
[7]
7. Cas9 modified according to any one of claims 1 to 6, characterized in that it comprises a mutation
Petition 870190078259, of 8/13/2019, p. 68/85
3 / Ί quadruple selected from the group consisting of M495V + Y515N + K526E + R661X and M495V + K526E + R661X + H698Q; where X is an amino acid selected from the group consisting of L, Q and S; preferably X is Q or S.
[8]
8. Cas9 modified according to claim 1, characterized by the fact that it comprises at least one mutation selected from the group consisting of K377E, E387V, D397E, R400H, Q402R, R403H, F405L, D406Y, D406V, N407P, N407H, A421V , L423P, R424G, Q426R, Y430C, K442N, P449S, Y450S, Y450H, Y450N, V452I, A456T, R457P, R457Q, W464L, M465R, K468N, E470D, T472A, I47H47, 474, 474, 474 , K484M, S487Y, A488V, M495V, M495T, T496A, F498I, F498Y, L502P, N504S, K506N, P509L, Y515N, F518L, F518I, N522K, N522I, E523K, I5N, K5, E523D, K5, E523D, K26 , F553L, V561M, V561A, K562E, E573D, A589T, L598P, D605V, L607P, N609D, N609S, N612Y, N612K, E617K, D618N, D628G, R629G, R635G, R653, 65, K637, 65, , W659R, R661W, R661L, R661Q, R661S, L666P, K673M, S675C, I679V, L680P, L683P, N690I, R691Q, R691L, N692I, F693Y, Q695H, Q695L, F7S, H7P, H698, , H721R, H723L, I724V, L727H, A728G, A728T, I733V, L738P, Q739E, Q739P and Q739K.
[9]
A modified Cas9 according to any one of claims 4 to 8, characterized in that it comprises a total number of said mutations between 1 and 9.
[10]
10. Cas9 modified according to claim 8 or 9, characterized by the fact that it comprises:
a single mutation selected from the group consisting of D406Y, W464L, T474A, N612K, L683P; or a double mutation selected from the group consisting of
Petition 870190078259, of 8/13/2019, p. 69/85
ΜΊ
R400H + Y450S, D406V + E523K, A421V + R661W, R424G + Q739P, W476R + L738P, P449S + F704S, N522K + G658E, E523D + E617K, L540Q + L607P, W659R + R661W; or a triple mutation selected from the group consisting of K377E + L598P + L651H, D397E + Y430C + L666P, Q402R + V561M + Q695L, N407P + F498I + P509L, N407H + K637N + N690I, Y450H7P16, Y450H + F553 Q739K, T472A + P475H + A488V, I473F + D550N + Q739E, F478Y + N522I + L727H, K484M + Q695H + Q712R, S487Y + N504S + E573D, T496A + N609D + A7R69; R6
a quadruple mutation selected from the group consisting of F405L + F518L + L651P + I724V, L423P + M465R + Y515N + K673M,
R457P + K468N + R661W + G715S, E470D + I548V + A589T + Q695H,
A488V + D605V + R629G + T657A and M495V + K526N + S541P + K562E; or five mutations selected from the group consisting of R403H + N612 Y + L651P + K652E + G715S;
six mutations selected from the group consisting of
E387V + V561A + D618N + D628G + L680P + S701F,
R403H + K526E + N612Y + L651P + K652E + G715S,
R403H + M495T + N612Y + L651P + K652E + G715S,
R403H + L502P + N612Y + L651P + K652E + G715S, R403H + K506N + N612Y + L651P + K652E + G715S,
R403H + N612Y + L651P + K652E + N692I + G715S; or seven mutations selected from the group consisting of R403H + A456T + N612Y + L651P + K652E + G715S + G728T, R403H + F498Y + N612Y + L651P + K652E + R661L + G715 S, R403H + Q426R + F478V + N6 G715S; or eight mutations selected from the group consisting of R403H + R442N + V452I + N609S + N612Y + R635G + L651P + K652E + F693Y + G 715S; or
Petition 870190078259, of 8/13/2019, p. 70/85
5/7 nine mutations selected from the group consisting of R403H + R457Q + F518I + N612Y + R635G + L651P + K652E + F693Y + G715S.
[11]
11. Cas9 modified according to any one of claims 1 to 10, characterized in that it additionally comprises at least one additional mutation that decreases the nuclease activity in a residue selected from the group consisting of D10, E762, D839, H840, N863, H983 and D986.
[12]
12. Cas9 modified according to any one of claims 1 to 10, characterized in that it additionally comprises at least one additional mutation that alters the specificity of PAM recognition in a residue selected from the group consisting of D1135, G1218, R1335, T1337 .
[13]
13. Cas9 modified according to any one of claims 1 to 12, characterized by the fact that it is S. pyogenes or an orthologist of the same.
[14]
Modified cas9 according to any one of claims 1 to 12, characterized in that it is fused to one or more other polypeptide sequences.
[15]
15. Method for producing a modified Cas9 as defined in any one of claims 1 to 14, said method characterized by the fact that it comprises reconstituting the modified Cas9 from one or more fragments thereof.
[16]
16. Protein or ribonucleoprotein complexes or mixed protein and ribonucleoprotein complexes or lipids, characterized in that they contain the modified Cas9 as defined in any one of claims 1 to 14.
[17]
17. Fusion protein, characterized in that it comprises a modified Cas9 as defined in any one of claims 1 to 14.
Petition 870190078259, of 8/13/2019, p. 71/85
6/7
[18]
18. Nucleotide sequence, characterized by the fact that it encodes a modified Cas9 as defined in any one of claims 1 to 14 and fragments thereof.
[19]
19. Nucleic acid, characterized by the fact that it comprises the nucleotide sequence as defined in claim 18.
[20]
20. Vector, characterized by the fact that it comprises the nucleic acid as defined in claim 19.
[21]
21. Method for producing a modified Cas9 as defined in any one of claims 1 to 14, characterized in that the modified Cas9 is expressed by means of a nucleic acid as defined in claim 19.
[22]
22. Cell, animal or plant, characterized by the fact that it is engineered using a nucleic acid as defined in claim 19 or a vector as defined in claim 20.
[23]
23. Nucleotide sequence according to claim
18 or nucleic acid according to claim 19 or vector according to claim 20, characterized (a) in that it is for use as a medicine in gene therapy.
[24]
24. Pharmaceutical composition, characterized in that it comprises the nucleotide sequence as defined in claim 18 or the nucleic acid as defined in claim 19 or the vector as defined in claim 20 and at least one pharmaceutically acceptable excipient.
[25]
25. Pharmaceutical composition, characterized in that it comprises a recombinant modified Cas9 as defined in any one of claims 1 to 14 and at least one pharmaceutically acceptable excipient.
[26]
26. In vitro use of a modified recombinant Cas9 as defined in any one of claims 1 to 14 in conjunction with an RN RN, or
Petition 870190078259, of 8/13/2019, p. 72/85
7/7 nucleotide sequence according to claim 18 or nucleic acid according to claim 19 or vector according to claim 20, characterized in that it is for genome engineering, cell engineering, protein expression or other applications biotechnological.
[27]
27. Kit of parts, characterized in that it is for simultaneous, separate or sequential use, comprising a modified recombinant Cas9 as defined in any one of claims 1 to 14 together with an RNAg, or the nucleotide sequence as defined in claim 18 or the nucleic acid as defined in claim 19 or the vector as defined in claim 20.
[28]
28. In vitro method for altering the genome of a cell, the method characterized by the fact that it comprises the expression in the modified Cas9 cell as defined in any one of claims 1 to 14 together with a guide RNA targeting a specific genomic sequence.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112019016765A2|2020-05-26|ISOLATED MODIFIED CAS9 MOLECULE, METHOD TO PRODUCE A MODIFIED CAS9, PROTEIN OR RIBONUCLEOPROTEIN COMPLEXES OR COMPLEXES OF MIXED OR LIPID, COMPOSITE, LIPID, FUSION PROTEIN, NUTRITION, NUTRITION, NUTRITION IN VITRO USE OF A MODIFIED RECOMBINANT CAS9, PARTS KIT, AND, IN VITRO METHOD TO CHANGE A CELL GENOME

---

JP6745391B2|2020-08-26|Genetically engineered CRISPR-Cas9 nuclease

---

JP6993063B2|2022-01-13|Genome engineering

---

JP2020534795A|2020-12-03|Methods and Compositions for Evolving Base Editing Factors Using Phage-Supported Continuous Evolution |

---

AU2019200922B2|2021-07-08|Chimeric polypeptides having targeted binding specificity

---

US20180112255A1|2018-04-26|Crispr mediated in vivo modeling and genetic screening of tumor growth and metastasis

---

JP2021523739A|2021-09-09|How to edit single nucleotide polymorphisms using a programmable base editor system

---

CA3064601A1|2019-01-03|Crispr/cas-adenine deaminase based compositions, systems, and methods for targeted nucleic acid editing

---

CA2989830A1|2016-12-22|Crispr enzyme mutations reducing off-target effects

---

JP2016538001A|2016-12-08|Somatic haploid human cell line

---

AU2016278990A1|2018-01-18|Novel CRISPR enzymes and systems

---

JP2003528594A|2003-09-30|Modified recombinase for genome modification

---

JP2021524272A|2021-09-13|Vesicles and methods of producing them for traceless delivery of guide RNA molecules and / or guide RNA molecules / RNA-induced nuclease complexes

---

EP3830256A2|2021-06-09|Novel crispr enzymes and systems

---

CN109072258A|2018-12-21|Replicative transposition subsystem

---

CA3129158A1|2020-08-20|Adenosine deaminase base editors and methods of using same to modify a nucleobase in a target sequence

---

JP2020510443A|2020-04-09|Method for increasing the efficiency of homologous recombination repair | in a cell genome

---

Casini2017|Better safe than sorry: new CRISPR/Cas9 tools for improved genome engineering

---

Rong et al.2018|18 Genome Editing of Pluripotent Stem Cells

---

KR20200135225A|2020-12-02|Single base editing proteins and composition comprising the same

---

Poggi2020|Gene editing approaches of microsatellite disorders: shortening expanded repeats

---

Zhang et al.2022|Gene Editing Through CRISPR-Based Technology

---

Seigel2018|Enhancing the Efficiency of CRISPR/Cas9 Precise Gene Editing for Cystic Fibrosis Gene Therapy

---

Doyon2017|A marker-free co-selection strategy for high efficiency human genome engineering

---

WO2020160517A1|2020-08-06|Nucleobase editors having reduced off-target deamination and methods of using same to modify a nucleobase target sequence

同族专利:

---

公开号 | 公开日

---

JP2020507347A|2020-03-12|

---

EP3583209A1|2019-12-25|

---

US20200149020A1|2020-05-14|

---

CN110520528A|2019-11-29|

---

KR20190116407A|2019-10-14|

---

AU2018221644A1|2019-08-29|

---

MX2019009651A|2019-12-18|

---

WO2018149888A1|2018-08-23|

---

IT201700016321A1|2018-08-14|

---

CA3053218A1|2018-08-23|

---

EA201991913A1|2020-01-22|

---

EA037825B1|2021-05-25|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

AU2016226077B2|2015-03-03|2021-12-23|The General Hospital Corporation|Engineered CRISPR-Cas9 nucleases with altered PAM specificity|

---

WO2016164797A1|2015-04-08|2016-10-13|University Of Pittsburgh - Of The Commonwealth System Of Higher Education|Activatable crispr/cas9 for spatial and temporal control of genome editing|

---

EP3129393B1|2015-06-18|2021-08-04|The Broad Institute Inc.|Crispr enzyme mutations reducing off-target effects|

---

US9512446B1|2015-08-28|2016-12-06|The General Hospital Corporation|Engineered CRISPR-Cas9 nucleases|US20150044192A1|2013-08-09|2015-02-12|President And Fellows Of Harvard College|Methods for identifying a target site of a cas9 nuclease|

---

US9359599B2|2013-08-22|2016-06-07|President And Fellows Of Harvard College|Engineered transcription activator-like effectordomains and uses thereof|

---

US9340799B2|2013-09-06|2016-05-17|President And Fellows Of Harvard College|MRNA-sensing switchable gRNAs|

---

US9526784B2|2013-09-06|2016-12-27|President And Fellows Of Harvard College|Delivery system for functional nucleases|

---

US9322037B2|2013-09-06|2016-04-26|President And Fellows Of Harvard College|Cas9-FokI fusion proteins and uses thereof|

---

US9068179B1|2013-12-12|2015-06-30|President And Fellows Of Harvard College|Methods for correcting presenilin point mutations|

---

AU2015298571B2|2014-07-30|2020-09-03|President And Fellows Of Harvard College|Cas9 proteins including ligand-dependent inteins|

---

CN108513575A|2015-10-23|2018-09-07|哈佛大学的校长及成员们|Nucleobase editing machine and application thereof|

---

US11236313B2|2016-04-13|2022-02-01|Editas Medicine, Inc.|Cas9 fusion molecules, gene editing systems, and methods of use thereof|

---

KR20190034628A|2016-08-03|2019-04-02|프레지던트 앤드 펠로우즈 오브 하바드 칼리지|Adenosine nucleobase editing agent and uses thereof|

---

US11242542B2|2016-10-07|2022-02-08|Integrated Dna Technologies, Inc.|S. pyogenes Cas9 mutant genes and polypeptides encoded by same|

---

US20190330606A1|2016-12-16|2019-10-31|The Rockefeller University|Compositions and methods using cas9 with enhanced spacer acquisition function|

---

US10745677B2|2016-12-23|2020-08-18|President And Fellows Of Harvard College|Editing of CCR5 receptor gene to protect against HIV infection|

---

US11268082B2|2017-03-23|2022-03-08|President And Fellows Of Harvard College|Nucleobase editors comprising nucleic acid programmable DNA binding proteins|

---

US10428319B2|2017-06-09|2019-10-01|Editas Medicine, Inc.|Engineered Cas9 nucleases|

---

EP3918059A1|2019-01-29|2021-12-08|Flagship Pioneering Innovations V, Inc.|Compositions comprising an endonuclease and methods for purifying an endonuclease|

---

WO2020257325A1|2019-06-17|2020-12-24|Vertex Pharmaceuticals Inc.|Compositions and methods for editing beta-globin for treatment of hemaglobinopathies|

---

WO2021076053A1|2019-10-15|2021-04-22|Agency For Science, Technology And Research|Assays for measuring nucleic acid modifying enzyme activity|

---

WO2021122944A1|2019-12-18|2021-06-24|Alia Therapeutics Srl|Compositions and methods for treating retinitis pigmentosa|

---

WO2022018638A1|2020-07-21|2022-01-27|Crispr Therapeutics Ag|Genome-editing compositions and methods to modulate faah for treatment of neurological disorders|

---

CN112680430A|2020-12-28|2021-04-20|南方医科大学|CRISPR SpCas9 mutant and application thereof|

法律状态:
2021-10-19| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

IT102017000016321|2017-02-14|

---

IT102017000016321A|IT201700016321A1|2017-02-14|2017-02-14|HIGH-SPECIFICITY CAS9 MUTANTS AND THEIR APPLICATIONS.|

---

PCT/EP2018/053717|WO2018149888A1|2017-02-14|2018-02-14|High-fidelity cas9 variants and applications thereof|

---